Description :
From Genome Similarity Track
Location :
contig_184:26784- 27787
Transcript NameFunction/comments
g14632.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
GCTTCGCAGCCACCCAGTGAGACTTGTTGTACCGCTCGCAAAACTTGGCCACTTCACCCACAGCTTGAGCAATGTCCGGGCGCGTACAAGTTGCGAGGTA
CATCAAAGCCCCCACCAACTCGCGATACGGGTACCTGGGCACGAAATCTTCGTCTTCTGACGGCTTCACCAGCTTCGAGTTGCTGTCCGCTGGTGTGTGC
ACTGCCTTGCACTTTTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTTGTCGTCGCGGTTGCGGTGGATCT
CGATGCCGAGACAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAA
GATCATGAGGTCGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGG
CCCTCCAGGTGCTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTT
GGTCTTCAAATCCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTC
CTCTGCTGCAATCGCCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCCCTGGACGTTGCGTGAAGCCCTTC
GCCACGAGACGAGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGATCGCCTTCTTGTCTGACGGCATGT
CCACCAACTTCCAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTA
CGA