Description :
From Genome Similarity Track
Location :
Scaffold_70:267832- 272506
Sequence
4674 bases(100 bases per row)
CCTCGCTTGAGTGACGAGGACATTGCCTTGAGCGTTGATTGGGCATCCCACCCATGAACGAGGTAAAAGGGAGTTTCCTTCCTCATCGTATCACTGGAGT
TATTGATGTCTTTCGGCGATTTCGTCCCAGTCCTGCTGCAACGGGTCCTCAGCGTATACGCGGACTGACTGCATCATCGTCTTCACCGATCTCTCCTGCT
GACCATTAGCCTGTGGTCGGTAGCTCAGGGTCGCCCTCGACCGAGACTGCATCATCTCCGTGAAGGCCTGAAAGACCTAGCTCATGAATCGAGGATCTCG
GTCATGACGGATCAATGACGGTGCCCCAAAGCATCGGTAGACACACTCCTCGAAAGCTTGCGCAACGAGTAGGGCAGTAGTGTCGGACATGCCTTTGCCC
ATCACGAATCCCGTGAACGAGCATTGGAACAGCAGGAGAGCTGTGTTACCACTGCGACTCTTTGGTAGCGGTATCACGAAGTCCATAGAGACCGGTTGGA
AAGGCCTCTCGGCTAGGATGTTCCCTGGCGAGTACCCGCGGAACTGAGGTCGGCTCTTACTTGAACTGCAATCAGGGCACGACTTAACGTGTTTCTCCAC
GTCGGCATACTGGCCGATCCAGTAAAAGTCTCTCCTCGCTCGATGTAGTGTACGGGTAATACCTTGATGACCACCTTCGAGTGAGTCATCACAGCTCTGC
AGGACCTCTTGGATCATCGTTGTGGGTACCACGAGTTTCATCTTCAACTCGATTTGTTCGTTGTCACTCGAACGACGGCTCGTTCTAGTGTAATACAGTT
CATTGTCCTCGCTCAACACAATCTGGTCCGCCATTTTCTATGCGTCTCCTGCAGCTCTGTATCCAATTTTCGCGTCATCTCCCCGGAGCAGTGCCTTCCG
ATTTGACCACCGTAGTTCTTCATCTTGGGCGGTGGCGATCCTCCTTCGGCGTTCTTCCTGTACTACCAGCGGGTCAATGTCTTCCGCGTTCGGTGGGGCT
GGTGACGTCTCGTGCGGAGCGGTGAGACTTCTACTTTATTCTGAGACTCGCTCGGCATACCATAGGCTTCCACTCGGTGAGATGCGTCTCCCTGATCGGT
GACCGAGACTTCATCTGCAAACCGGACGTGTTTCTGCTTTGCTCTCGCTTGACGTCTGGTCATCACAGCCACATGTCTAGGTTCAGTCTGGTTCTGCCGT
CTGTGGTCGGTTTCCCTTCGCACAAAATTAAAAAAACTTGCTGTGAGGTTTGACAGAGGCTGATACAGCCCATACTGTGCTGGCCGAGGGTATGTCCTCG
ACGACGCAACTGTCAGCAACCTCGTAGATGACTTCAGCGATACGGTTCAGCTTCATCAGCTCTAATACTCGGTCGTCTGACGATACCGCCGTCGACCTCT
TGCTTTCGAGCGTCTCGCTTGCCAAAGGAGCGGCCGCAGCGATAAACTCTCTCATCACACGTAGGTACTTCACCGGTCGAAACTTGGTCGTGATTTCTTG
GTGATGGCTGAGTTGCTTCAACAAACACTCCTTCAGACAGGTTATCACCCCTAGTGTTTGCTGGATAGCGAGCGTCGAGTCGCCAACGACGATTAAATGG
TCGGCCCCGTGCTGTAATGCAGCAGAGACACCGTTGTTCATCCCTGTGCACTCAGCGAGGTTAACTCGAGGTAAGCGCTCGCAGCGAGCACTACCGTCTA
TTCCGGTAACTTCCATAGTACCCATGAGCAGCTCCCATAACCACCGTTCTTCTCAGTCTTCGCAGACCCGTCAAACGACATGACAAATCCTCGGTAGGAC
CGAGGTAGGCGTGCATAGAGCGGATGCAGGTCCAAGCGAGCAGTCGGTGACCCTCGGGTCCGGGGCGTAACCATCACCAGTGACTTATCCAAATCAACGA
AGTTCGTCAAGCCGGCTTGAAGTAGTTGGGCAAACGAGCAGTCGGTCTCTTTGACTCGTTCAACCAACCGGTGCCACGGCGACAGCAAGACGGCGAACTG
GGTAGCCCGACCGAACAATGCCTTGGACTTGTGGACCCAGTCGAGCGTTGAAAATCGAGTGTAGACCCGGATTCGCTGTCCAATCAGTTGGGTATAACAC
ACCTTCAGTATCAGCAAAAGCGCGAGAATTGCTTTCTCGGTCGGGTGATAATTCATCTCCGCGTCCTTCAAAACACGTCCACAGAAGCGAACGGGATGTA
GTTTGCCCTCATGCTCTTGCATCAACGTGGAGCTCAGAGTCCAGTCGTTGGCGAACAGCATGACATGTACTTCCTTCTCTCGGTCGAAGTGCCGGAGAAT
CGGCGCTGTCGAAACCTTCTGTTGGAGCATGGCGAAACTGTGCTTGGCCGCGGTGAGGTCACCCCCGGGCTGGAAGTTCTCGTCCTTAAGCTGATACAGC
GCTGCCCCATAGACCGCAAAGTCTTGGATAAAACGACTGTAGTAATTGAGTGCCCCAAGGAAGGACTGCATTCCTTTCTTCGTTGACGGGAACGAAAGCT
CGGTCACCCCTGCTAGCTTCTTGCTGTTCGGTCGTATACCTTCTGCCGAGATTTCGTGAGACAGGAAGTCCACCTTGGACTGCACAAATATACTCTCGGT
GAAGATGATACTAATACGGCACTCTTCGAAGCGTGTCAGCAATCGATCCAGCGTCTCCAGGCATGACCCGAAAGTCTCGGCACCGAAACAAATATCATCC
ACGAATGATCGGCGACTGAACGCTGGCGTCAACATGGACTCATCCGGCTCTCCATTGGCGAACATGTCGGCGGTATGAGTGTTGACGAATTCGGTCACAG
CTCCCCTATCCAGCGAGTTATCTAGGTCGGCTTCGAATTTGGTCCGAAATGACTTGGCAGTGCCAGCCGGAGTCCCGTTCACCCCAGCACGAGCTCCCTT
GTCATGTTCTTCAGCTAAACGCATGCGCTCCGAGAATTTAAACCATCCTCCTTTCGGCTGGACGAAACCCCAAAGCGCGTTATCAATCATGTGCTGGTAA
ATCACCGGAGCGTTCTTCAAACCAAAGGGCATGCGCAACCAATCGAAGTGCCCAAGCGCAGAGACGAAAGCAGAAATTTTGCAAGCACGTTCGGTCATCA
TAATAGTCCAGAAGCCGCTGGCGGCATCCAGAGAGCAGAACCACAGGTATGCCTCCATGTCCGTCAACAGGTCATCCACTAACGGCATAGCGTACTCCAT
TATCTCGGTGATCGCATGAACGAGCTTGTAGTCAATACACAAGCGAATATTCACTCCGTTCTTCTTTAAGACAATGACGATTGGCGACGCCCATGGGCTG
TCTGAGAAGGAGATAAACCCAGCCTTCAGAAGGACTTTCAGCAACTCGTATAGCTTGCCGAGGAAGCGGAGCGGGGTTCGCCGAGCTTTCTGCTTGATTG
GCGCGTGCCCTTGTACGTTGATGTCGCACACGACACCGTAGGCTGGAGGCGGCAGAGCGTTGTCACTCGCGATCATGATCTTCTCATGGCTCTGTAGCAC
GTCGACCAGTCTCACCTGCTGCTTCTCGCTCAAATCGCCATTTTGGATATTCTGACCGGAGTAATCCAATGTCGTCTCCGACGCTTCGGTCAGGTCTGGC
AAGAAACGCCAGCTCTTGCGCGTAGTCGGTAAGCTCAATGTCGTTCGCCACGCGTTCAGAAACGTCGTTCGCGGCGTCGTCATCTTCGATAGTCCCTCTG
CAATCATAGCATGCATGACCGAAATATAAGTCGCTTCCAGTAATTGTGGGTCGTCAATCGAATCTTCGCCTAAGTCCTGGAAATCAGTGGCGGCGTCAGC
GGCGGGGTTCTGGTTCCTGTAGGAACATCGTTCGGCCCAGGATCATGTTCGCCCCAGTCGTCTTCACCACTGCATATCGCAGCCGACGCGTCAGCCGGAC
CCAGGCATGGTGCAACAGCTTCCGTCGACAGGCCGTTCGCTGCCGCTGGCTCCGCCTTTGTCATCTCGTCTTGGGCATCCTCCGATTTGTCGTTCGTCTC
ACTATCACCTTCACGCAGCTCAGCACTAGTCTCCGACGCCTCGACCGAGACTCCCTGGCCATTGGCAACCGTACCGGTATTCAGGCTCGTGGACATGCAC
CTCGTCCGGCAGAGCGGCGAAGCATCATGGGTTTCCGAGGCATTCAGGCAAAGGATTCGTCGTCCGAACTGTCGTTCGGCACTCTCGTCACCTGCATTGA
CTCGAGCAGTGTCGACCGAGCCTTTACAGACTCTAGGGTCATCGTCGCAACCATGTACATCGGGTGGCGAGCCAGGGGACTTGTTGGCGACCTCTCGGCC
AGGTCGGGGCGTCCGGTGGCCTCGGCAGGATCTTCCGAGGCGTCGGATAAGTCCTGCGCTCGACCGCAGGCGGTTGAACAGCCATCCATTGCTCATAGCG
ACGACGCTCTCGTCCATACAGAGTCTCATCACGACTCGTTGAGTAGGCCAGCACGTGCCACTCCTTGTACTTGTTAGAGTCCAACCTTGCGTAGCCGGTC
TCACGCGGTAATTCACCATGCGGCACCCATACCGTGACGGTGCTGACAGCGGCCTACACCTGCCGACACAATCTATCATTGGTTGAAAGCCTGAGTTTCT
TTGATTGGTCTAAAACGGCTATTTTGAACCCTTCTCGCATTTTCATTTCGTGGTGGAGGTCATACTGGCGGCGC