Description :
From Genome Similarity Track
Location :
contig_50:267830- 270393
Transcript NameFunction/comments
g9921.t1hypothetical protein

Sequence
2563 bases(100 bases per row)
GCGTTCACTGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTA
CTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGC
CGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGACGTGATCAGCATCTGG
AACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACAT
CAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCAC
CTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAAGTGGCTGAG
TACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGA
CCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTC
GCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGATCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCC
AAACGCACTTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTT
GCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCC
TGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCATGGAATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTC
TTAACGTCGAGACTGGAGTCGCGCGCCACCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCG
AGGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATACCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATC
AGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAACTGTGCAGGAAG
TGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAGCTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCG
TGTCCTGCCGGGGTTTCCATGGCGAATTGTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGT
ACGCAGATGCGGCTGCGGTGACTTATTCAAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCC
TCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGT
TCTCAGGAAAGACCTCAGCTAGCAGCTCCCGCGCAGACGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCAACGAGACTGTGCTGCTTCTGCTG
GAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTC
TCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTTATCTCAACTGGCAGTTGACAGCCGACCCGAGCACTTTCAGCCACTCCGAGCTCCT
CGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCC
AAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTA
CCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGC
TCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT