Description :
From Genome Similarity Track
Location :
Scaffold_2051:2678- 4103
Transcript NameFunction/comments
Phypl_g14607hypothetical protein

Sequence
1425 bases(100 bases per row)
GTGTGTGATTACCTCTGCGAATAGTTTACAACGACGTGATCCAATTGTTTTTTCCGGCGCACAAGTTCTATGTCTGAATGCAGTTTTCGATGCTAATCGG
TGTAAAGCCATTCGTTcctctgcttctgcttcttggccttcttctccgctgTGATTTTCTTCCAGTCAAtgtgcttgcgcttcagTTGCTCCTTCCTGCG
TTGTGCTTCTTCGCGGTTTTTCTCTAGCTCGGTCATGTCAAAGAAGTGGCTCATTTGCCGCCCCGCACGATCTGGTGCGATGCCCGCCTGTTGCCAATAT
GCGTCACCCCCGAGTTGCTCGTACTTGCCTGTGAGCCGATTAAACTTGGCCCGAGCGACGTAGTTCACACCCGAAACGGTCTTCTGACTTGCACCGATCG
AATCGGACTCGGGGACTTCAGGTGGAATCCAGTCGGTCAACTACACAAACAGCGTACAAGACGAGAACTTAAGCATCCAACCACTTTCGTGCATGCATCT
CGTGCCAGATAACGTCCTCTGGAAACTTACCCCGGAGACAATAGCCGCCTCTGGCTTGGTCCACTGCGTTACCCCCGTGACCACATTGTGGTAGTAGTAT
CGCTGCGTCTGTGCGTCGATGTGTTGCTGCCAATCCGCTTTTGCTGTCCgaacagcatcagcagccgTCTCCCCATCCACAGTAGCTGCCGCAGAAGGAG
CGCTGCTATCAATGCCGCTCAAAATGGCGTTCAGTTTGCTGAGGTTGCCCGACGGGTCCAGCACTCGCTGCGTCATCCGCGCCAGGCGTTCCGTGTGCAC
CCGGTTAAGATGAGCCTGATACTCAACGGAAACCTGGGGACCCGCCGGGACTGCTGGTGGCTCATCGAAGCCCTCAGGCTGCTCCCACTGCGTCTTCCCC
GTGCTGGCATTGTAGTAGTACGGCTTGTTGCTGGCAGcgtccacgtacttggccCACTGCCGAGGCTtaacaccagcagcgccgacctCTGTACGCTCCT
CTGTTTGTTTATCATTGCTCCCAGCCTTGTCACATCGAgactcgtcctcctccttcttaTCCCCTTGAGGCTCCtgatcagcagcttcggtCTCCTCTGT
cgcctcttcttcttgctgctctgctgcttcctgccCCTCGGGCTCCTGTTCCTCCTCCCCTTGGTCCTCACTCTCCTGCTCCGGCTCGTAGTCTCCGGGT
TTGTCCCATCGACTGGTGCCGCTCGCTTCGTCGAAGTAGTAGGTGGTTCCggactcgtcgtccacgaactcgcgCCACTTCGGGGCCTTGTCCTGGCTCG
CGTCTTGCGCGCGCGGAGACTTGAAGCCGGCAGGGACCTCCCATGATGACTCGCCTGAGTGGGCGTTGTAGTAGTACGCCGAGCCGGAGGCCTCGTCCAC
GTGTTTTGCCCACTTGCCGCCGGTG