Description :
From Genome Similarity Track
Location :
Scaffold_300:2678- 3733
Sequence
1055 bases(100 bases per row)
ATTCAAAGCGATGACACGCTCACGTTCCTCAACACCTGTTTGTAACAGAGCACAGTCAATGGCAAAATCCGAAGCGTCACAGACGACACTGAAAGGCCAA
TCAGAATCTGGCAAAGCCAAAATCGGGGCATGTAGGAGAATCTCCTTTACGGCCTAAACAGCCTCTGCTTCGGTGATAGTCCAGCACCACTCCACATCCT
TTTTAAGGAGATTGGAAATGGCAGAGCCACATCAGCGTAATTTTGCTACACTTGTGCAAGTAATTGGCAAAGCCAAGCCACTGCGTAGGTCTTTTTTTTG
TTCCAAGAAACTGGCCGATCCAATATGGCCTCCACCTTTGCAGGATCTGCCCGAAGGCCTCGCTTCCCAATGAAGCATCCCAAAACTTAGATCTGGTCCG
CAACCAAAGATACATTTTGGTGCATTAAAATAGAGCTTATTAGTGCACATGCACTCGAGCACAGGTCGTAAATGGTCGATCTGGTTATCTACTTCCGACC
GACCCTGTTCCGCCCGACTATGGGCAAACGTGTCATCAAACTATGTTCTTGCGTACGCATGGTGAGGACGGAACAATTGCGTTACCAGACGATTAAACGT
AGCCGGGGAATTGGAAAGCCCCTGGGGCACAACCAGCCACTCCCAAAACATACCACTTACCGTACTAACCGCTCGTAAGTTGGATATCACTTGCTCGCAT
GATCATTTGATTATAACCATCGACCAGGTCGAGTGCACTGTACATTTTACATCCTGCCATGTTGTTCTGAAGAACGTCGTGTCTAGGAATGGGAGGTTTT
TGCCGGTATAGTGTTCGCATTAAGCTCATTATAAGCATGCACAATATACCACTTACCATTAGGCATTTTGACACAAAATGTCGGTGTGGAATAAGGAGAC
TTGCTCTCCCGCACCATTTCCACCGCGTGCTTAGCACTGAAAAACTCGTCAATGACGTCACATTGTTCCTTTACTAAAGGCTACTGCCTTGTAACGCAGT
ATTTGGTTCCAGGAACCAAGTCCATTTCATGACGTACGCCCCTATCAGGAGGTAA