Description :
From Genome Similarity Track
Location :
scaffold_57:26772- 31547
Transcript NameFunction/comments
g2321.t1 conserved hypothetical protein
g2322.t1 conserved hypothetical protein
g2323.t1 hypothetical protein PHYSODRAFT_513613
g2324.t1 hypothetical protein PHYSODRAFT_262310

Sequence
4775 bases(100 bases per row)
ATGTCCAAGTGGAGCAAGAAGAACCGAGCGCCCGCCGGCTACGCGTACATCCAGCCGGTGATGCACGCGCTGGAGAGCGAGTTGCGTGAGAGGATGAACG
AGCCGCACGAGGGCAAGCGCCAGTGCGAGGCACTGTGGCCTGTGCACCAGATCAACTGGCAGCGCAGTCGCTACGTGTACGACATGTTCTACAAGTACAA
GAAGATCCCCCGGGAGGTCTACGACTACTGCGTGAAGCGCAAATTGGTGGACGCCAACCTCATTGCCAAGTGGAAGAAACCGGGCTACGAACGGCTCTGC
AGCACGTTTGCCATTAACACGAAAAACTACAATTACGGTACCGTCAGTATCTGTCGCGTGCCGAGACAGCAGCTCTCGGAGGGGCAAGTGGTGCAGGAGA
AGCACAGTGGCTGCAGAGGCTGCGCTTCTGGGCCTGGAGGGTACCACAATATCTTTGGTAACAAGTACGGCCAGTATTTGGCCAGAATTCAGATCGCTCG
AGAGGAGGCAGCTAAGAAGGGGGAGCAGACCGAACAGGTGTGGGCTACGGAGCAGGAGGAGGAAGAGTATGAAAGTGGAGAGGAAGATAAGAAGAGGAAG
AGGCAAGAACAGACCAAGAGCGACAGTGACAGTGACAGCGACTCCAGCGGCAGTGACAGTGATGAAGAGGCCAAAGAGTCCGAAGCACCCGTGAAAAAGC
AGAAGTCGGACGAATGAAGTTGATGCAGAGTTCTACCTAAAAGGGTGATAGATCCAATGATACTTGCCGTGTGAATTTGATTCAAGTGTTTTCATTACTT
ACCAGACGTACGGCAGCAGCTTCCACTTGGGCACTTCGTTTATTCTATCGCGGAACTTGTCGTCGACCCACTGCGAGCTGATCTGGGCGAGCAGCACCTG
GTTCACAACTACCCAAAGGGAGACGAGATACAGCATGGTGGTCGTCCCGCCAGTGATCAAGATAAACCCTGCATACAGCATGATCTCGGTCGTGTACAGC
GGACTACGAACGATCTCGAACCAGTCACCGCGAGGAATCACGTGTTTCATGTTGTTGGCGCGTTTTTGCTTTGCCAAAAGGTAGTTGCAGCGAGTTTGAT
GGTAGGAACCAATGAGGAAGAGCAGAATGCCCAACACAGCCATCGCTGCGCGGGTAGTTGTGAGCTCGTGGATCGTAACGGAGTCCGGATCGAAGAGCAC
AGACAGCACCGTCGCAACGTAGTGGTAAGTGCCTACAAACAAAACTAGCATCGCAAAAAGAGTTAGTTAAAATCCAGTAGGCCAGGACATCGTCTGCGAA
ACGTACTGCAAGCGTGCATCCTGGCATCTCCAAATTCCGTGACGAGGAGCGATTCAAGGAACCGCCGCGTAGTATGCACTGAAAACAGCACCAAAAACGC
GACAATATGCGGCTGAATGGCGACGGTTTCTCCATCCGAAGCATGTGCAAGGTGCAGCGCGTATTGAACCACTTGGGTGTCTTGCCAAAAGGCTGCAATC
GCCAGCATCGCGATGCTGTGCAGAGCTCCGATGAGGTAGAACCACGTCCAGTAGCTCTTGGGCACCTCCAGACGCAGCAATGACATACCAGGCAGTCGCG
AAACAGCGGTGGGGGTACGCATCTTGCCCTGCAGCACGAAGCCACGACATAAGCTACTCCGAAACGAGAACAGTCCGCCAGCCACGGCGATCAGCCACGT
TAGTTGCCATAGCTCCAGCATTCCCACGGCCAACATGGTGATGGCAGTTTTTGACCAATCATTGTCGTTCTGTTTCTTGCTTCAACCTTCACTTCGATGT
GCTTTCTTGCTTGTTTGTCTATCAATGGCATCATGTTCCGATAAGAACTTGCGCCGGAATTGGTGCCGGTAAATAATGCAGCTAAAATGGGTCGTTGGTA
TTCCTGAAGGCAGGACATTCGAGATATTGCAGTGAAAGAACCTACCGAGGAGAAATGGTATCGCGAGGCTCTTCCATCCACCACACGCGCCGTACCAACA
ACCCGTTCATGACCACGAGCTCTGGGATTGTTGGCATCGACCTGCATGAAAAGGTGGCGTTTGATGCCCCTCAACTTCGCAGCAGCTCGAGCAACAACCA
GATCAACAGCCAGCCACGAGCTACAAACACGTTGACTGAGTTCATGTACCAAACGACCTCGGGAGGTTTTGGCGAAGGGGTCCGGGCACAAGAACGTTCC
AGACTGAGCCAAAGGATGGACAAGCTCACTCTACACAAAGGTTTGTGCACCAGAATCTGCCGTTGCTTGGCCAATAGGGGCGTACTCATGGTTGTGTGTC
TTCTGCCTAAACAGAGGTGGAAGCTTCCGGTCTAGTCACAATCCGACAAGTCGACGTTGCAACACCGGAGAACTGCGCCATCCGCCCCGAGGAGCTCATG
CCCAGGCCCATCGACATCAAGCCCATCACCGAAGCACAAAGTCAGCATCCTCTGTACGCCACAAGCTATCGAGACATTGGTGCGGACAAGGTGCAGCTCA
AGGTCGATATCGAGCGGCTCGGGCGGCCCAACACCTTCACCAACTCCTTTAACGGATTCCGGTACCGCGACTTTGGACTGAACACCGCTGTAACAAAATC
TCGAATCTGCGACCAGCTTGACTATTCTTGAGCTTCGAGTCCATTCACCTGTGCTAACATCCAACAAAACAACAACAAAAAACTCAAACCAAACGCGACA
CTTTACCCGTTCTTCCATGAATTTTTCAATTGCTTCGGTCGCGTCCTGCCAGCACTGATTGGAACTCTTTCCCTCCTCTTCTTCTGCCAGTAAGTTGTTA
CTTAGTCGTAGCCCTTCTTGGAAAAGTCGACGAAGACCGTCTCCTTGGCGGGCAGGGGCGTCATGTCGATGTTGATGGCCTCGAGCGGCGACACCTCCAC
GTCCTCCGGGATCACTCCGTCCGGGAAGCACACGTCCAACGGAATGGGTGCGTTACGCATGAACAGACTGCCACCGGGCATGTAGTTGAATATATAGCGG
TCCGGGTGCGTATAGTGGTCGACCTTCTCCTGCGCCTCGCGCACCAAGCGCTTTGCCAGGCTAATAAATAAACAAGATAGCAACAAGAGGCAAAAGTGTC
AATAGACCACCGGAATGCCACCAAACAATAAAAATTAAAAAAATGTCAATCCACAGTAGTAGATGACATACCCAGATTCTGGGTCCAGGCTGCGGTTGGC
GTCGAACTCGGCGCGGATCTTGGTGGCCTCCTCGTTCCAGAGGCGGCGGTCAATGACCCACGAGTCCAGCGTCTTGAGCGACTGCTTGTACAGGCGCTGC
ACCTTCTGCTTGTGCGAGAGCTGCTGCGGCGCGCCCACGAAGCGGCCCACCACCTCGCGGAGGGTCTTGTGCATGTTCGGGTTCACCACGGGCTTCACCA
TCGTCGCCGGCGTCGAGTCCTTCTGCTCGCGTAGCTGCCCGTTCCGAGTCGATTCAGAGCCGCACACTCGGAATTCGTTCGTGCGACATTAACGCAACAT
TTACGATGCCAAGTGAAATGTTGCACGAATTAGGGGCGGTCCGGTTCACCCTGCATAAACCGGTTCGCGTCAAGATAATCAGAGTGATGGTCAAAAAGGC
AACTTGCAGTTGCACTTTGCCTATATTTGGAGGGACATGGGGGTGGATCATGAGGAGCGACCATCGACGTCGGCGTGTAGGAAGGTGAAGAAGATGCAGC
AGAAGCCGGAGACGAAAGTGCCAAAGCTCAGCAGCAAGAACAGCAGTAAGCGCCGACAGAAGGACGACGCAACACATCGACTAACGAGTTTATTGAGGAT
TGAGAGCAACCAACTTAATGAGCAACTGCTGGTCGCGAGTGAGAAGGGCAAACAACGCGCCGTCTTCCTGCTGCTGCATCAGGGCGTCGACAAGGACCGA
TGCAAGGGCCTTGTACGTGTTTTCAGCTTGCAAATGGAGATATTTTGCAACGTAAAGTTAAACTTTTGTTGCTATTTTGTAGCTCGGGTACTCTCCGGTA
CATCATGCTGCAGCTAGAGGGCATCTGGAGGTGTTGAAGCTTCTGATTGACTTCGGGTGGACTGTTGACGTTCGTAATGACGCACTGGAGACTCCTCTTC
ACCTTGCGTGCTTTGATGGCCACACTCATATTGCCGAGTTCTTGTTGGATCGTGGAGCGAATATTAACGCGAGGACGAAGGATCAAGAGACTCCGTTGTT
CTACGCTGCGAGGAAGGGACAGTACCGAACTGTTCGGTTGCTCGTTCGAAGAGAATGCGACCTTGCAGCGAAGAATTGCTACGGCGACTTGGCGGAGGAA
GAAGCTCGTGATGCCAAGACTTTAGCAGAATTTGTAGCGGGGAGTGAAGATCTGCAGCGAGCTTCGACTGCTGGAAAAGATTTAAACGGTGGTGAATACG
TTCTATCTCAAGTGCTACGTGAGCGAGTCCTATCGTTCTTGGACCTGAAGAGTTTAGGCAACGCTTCGCAAGTTTCCTACCGATGGCATCGAGCTTCCGA
TAACCCGTCGCTGTGGAAGAAGCTCGGCGTTTCTCAGTGGGGGCTGCTGCTTAATGCCACTATGGGAATGGGGACTGTGCCTCAGATGACGATGATGCGC
ACTGCTACCAGCAACTTATTCCGCCTAAATCTCTCTACGACTGTATCTCGGCGTCCATCTAGCTGTGACCCGGTTATCCTCGGTCGAGTTATACCTTTAA
GTGCCAAGGAAAAGGAGCGTCCACGGCATCCAGTAGAACTGCGACCTCGGACTGCTAGTATTGCAGGAATATAAA