Description :
From Genome Similarity Track
Location :
Scaffold_29:2677- 6272
Transcript NameFunction/comments
Physo_133934reverse transcriptase

Sequence
3595 bases(100 bases per row)
ACTTTGGTGTAGACACACCAAAGGCTGCATACATTTACGATCACCACGACGGGTGGTTCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCAATGAGCGACATGCATAGCGTAGGAATGCTGCCAACCAGTCGTTGGCAGATTCCCAACTTAGAATATTACATTTAGAGGAAATCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGATA
AACTAAGCTACGCTTCCTCACATACACGCGTACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGTCTCCGCACGAACGCGGAGCTAAGAACCTTCCCATGGATACGGAGGTGTCCATGAAAAGCTCCACTACGCCTGCA
ACTCACGTTGCACGCGCTGACTGTCCCCATCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTATTAACAGTCATTGGTGAGGCGGCTGTAGCTACGA
TGCTGCGTATGCTAACGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAGGGAGCAGCGAGATGCTGCTTCGTTTACCACGGTGTCGTCGGG
GACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGCGAGCCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCC
ATTGCGGCTCGACGCATCGTCGACCCGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGGCGCCGACTCT
CGGATCCTACGTGCTTTAGCACGTACGAGGGTTTCACGGAAGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAAAGAGTTCCGGTCGAGGGCGGAGTTCCT
CGACCTGCACCAGGGCAAACATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAG
GTCGTCACGTTCATGAAGGGACTCAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTCCTCTTGCAATGC
AGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGACCACGCCACGTCCGGTAGTAAGGACGGCAACTGCTGGATCCCAGCAGTCG
CAGGGAAACAATGTGCGATGCAACCGTTGCGGTAGAGTCGGTTACTTTGCTCGGGAGTGCACAGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTG
CCGGGCACCGTTGCAACCAAACAAAAAAACGCTGGACGCCGGTAGGGGCGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGAC
ACTGAGGACTGCAGCCCCCAGCGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAACGTGAACTCGATGAGAGCAAGC
GGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAGATACCTCGAA
GTATGCTAGAAGTGGGACTGGCGACGGGCGCCGTCGTGAAGACCGAGAAGCACCCAAGGGGCGCGGGTGAAGCAGGCAAGTCACACGCCTCAGCCAAGGA
GGCTGACGCGGATCTGATTGGATCAGATCTGACCAATAATAAGAGCTAAGGTGACAGTACACCGTCGACTCCGGGAGTCCATGGCTTGGATGAATTGGGT
TCGTCGGCTCGGGGAGCCGACGAACCCTCCGTAATGGGGGTCTCCGCTAATGGTAGGCGTCGAGGTATTAACGTCGCATCGGTTCCGGGAACCGACGCTG
CAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCAGGCGACCAAGCCGGGCT
TGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACCAGTCCACGGCTGGGCCTGGACGGGGTCAAGAACCAAGCGGAGCCGGG
CTCCACAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCAG
AGAAGCCGGGCGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGTTCCGGTACAGGGAGATGACCCTCGCTAACCCTCCGACACAAGCATCGGAG
TTTACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGAAGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGA
AGAGCGAGAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACGACTGAGAGTGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGTTTTGAGGAGCA
GAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAG
GGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCTGCAGTAGCCACTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCT
TCGAAAGTCGTCGCAAAGCTGGACAAATGCGGGAATCGAAGTCCCCACACAGTGCTCCGACGTTCTGGGTCAAGAAGCCACAGGGCGGTTGGCGCATCGT
TCATGCGTACAACAAGCTGAACGATGCAACGATACCGGCGCAGACGCCGATTCCTCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATCTAC
AGTGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCGCGGCTGTGAGCACGCCGAGCGGCATACTCTGGGAGT
GGCTGGTGATGCCGCAGGGGCTGAAGAACGCCCCTCCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTT
CGACGATGTGTTCGTCCACAGCCGGGCTGCGGACAGGATGAGTGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCAC
AAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGTGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGA
AGGTCAGAGTGATCAATGAGTGGCTGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTA
CGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGC