Description :
From Genome Similarity Track
Location :
Scaffold_207:2677- 5720
Sequence
3043 bases(100 bases per row)
GGCTCTACGAATTCAATCAAGGCGCAAGAGCGCGGGCCCGTTTCCAGGCCATGCAGGCTGGAGATGATCACCCAGGATTCTAGCACTCTGGGGTGACAAT
GACCCAGAGTTACACGTGATATTCAGGGGAAACTCTGGGTGACACTGTGAAACTCTGGGGAAAATCGACGGAATGTGTGAATATTGGAGACGGAAAACGT
GAATGTGATTTGACTTGATTTGATTATGGAAAAGGTGATACTGCTGAGGCTTTGGCAGTGTGTGAGAAGGAAGATGAAGGCGGCGAGCTTTACAAGGACA
TGGAGACAGTAAACGAAGTTGGATGACCCAGAGAACAAGTCAGAAAAATGATGAATTTCTGAGGAAGACATTGAAATCGAGATGAAATCCTGGGTATTAT
GGAGAGTTACGCTACGACATGTGAAATTCAGATGGTTCTCGGGATTTGGAGGTGACCTTGACTCTCACGAGTGCTTGAGAGACAGCGGGTTGAGCTTGCG
GATGACCAGGGGCTTGATGTGGCGCTTGATGTTGTTCAGAACGTATTGTAGCCACTCATCGTCGTCAGCCGCCGTGTTCCATTGGACTCGAGCAGGCTCA
CGAATGTCCAACGTCGCTAGCTGGACGTCTAAGTCCTTGCACTTTGCTCCCCCGAGTCTCTTGGCCCTGGGATCCTCCCAAATCCAGTAGCAGCACTTGT
CCGGGAACTTCCAGAGACCCGGTTCGTGCCACAACGACGGGATGAACCCAGGAGTGTTGCGCGAGCGCTCGACGAGCGTCTTGTACGCTCTGCGTAGTGC
GTTTCGACGCGACTTCCGCTGAGATTCCATGGTGGCGTCTGCTTGTTCTTCAGTCGGAATAGGCACCCATTGCCCGCGCTCCCAGATTGCCTGTGCGTGC
TTGTGCATGATGTCCACGACGTCCTCCATCAGCTTGAGCGCTTTCGCGGAGAGTAGCTCTCGCTCATGGAAGTAGAACATTTGGAAGCGACCCTGAAGCA
TAGTCTCCCAGGGTTCAGAATCCAGGACTTCTTGGTATGCCTCACGGTCCCAGCGCTCGTGAGCAACGTCGTACGAATACTTGTGGATCTCGTACTCTGG
GAACCCGGGAGTCTGGCAAGACGCACTCTTGGTCGAACTTGGATATTGAACAAGAACCCCATAGATGCGCCAGGAGGTCTCGTTGTCCTCAGGGTCTTCG
GCCGTCATCAACTCACTTGAAGTGAGCTCCGAGTACGATTTCCGTGCGAGCGTCGACGGATGCTTGGAGCGTGATGTAGCCTTGGACCCCTGAGTACCAC
TAGAACCCTGAGTGGCAGAAGTGTCTGTCTTGTTTCCCGTGCGACGTTTCTTCTTCGACTTCGAGTTGGAACCCTGAGGTTTCTTGCTTGACTCAGAACG
GGGGCGCTTAGCGGGAGGCTTGACTTCCAGGGGTTCTTCTACCCCATTGTCGTCCTCTGCGTCGTCGTCGTCCTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN