Description :
From Genome Similarity Track
Location :
contig_184:26767- 28703
Transcript NameFunction/comments
g14108.t1hypothetical protein

Sequence
1936 bases(100 bases per row)
GGTCTTCAAGTACTTCAAAATCCGCTTCGCAGCCACCCAGTGAGACTTGTTGTACCGCTCGCAAAACTTGGCCACTTCACCCACAGCTTGAGCAATGTCC
GGGCGCGTACAAGTTGCGAGGTACATCAAAGCCCCCACCAACTCGCGATACGGGTACCTGGGCACGAAATCTTCGTCTTCTGACGGCTTCACCAGCTTCG
AGTTGCTGTCCGCTGGTGTGTGCACTGCCTTGCACTTTTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTT
GTCGTCGCGGTTGCGGTGGATCTCGATGCCGAGACAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCG
ATCTCCGCTTTCGTCCTGCTGAAGATCATGAGGTCGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCG
CCGCTGACCGATGGAAACCTTGGCCCTCCAGGTGCTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAG
GCACTTCTTGGTTGGGTTGACTTGGTCTTCAAATCCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCC
ACATTTTCAGCCTCCATGTCTTCCTCTGCTGCAATCGCCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCC
CTGGACGTTGCGTGAAGCCCTTCGCCACGAGACGAGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGAT
CGCCTTCTTGTCTGACGGCATGTCCACCAACTTCCAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTAC
TTGCTCCGCATGACTTCATCGTACGACACCGCGCGCTCACCGTCGTCGTCTTCGGTGAGGAAGCAGTAGAGGGAATCGAACTCAGCCTCGTAGTCGTCCA
GGTTGAACTCACCCCTTCGAGTCCCGGGAAATTCGTCTTGGTAGCGCACGACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCTCTTCGCCGTC
TCTCCCTGGCGTGCTAGAGCCACGCGTTGGCACAGATCCGGTCGGTCCGCTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGTGCTGAAACCG
TCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTTCTTCATCGTTGTCGATGATGTCGATCACCTCCTGGTTGCGCGTCTTCGCCATTGTGACCGGTGGCG
CTTCAGCAAACGTCACACTCCTTGAAATCACGATCGATCCGTCGCTGGGGTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCGTAGCCGAGAAACACGCA
CTTGATCCCCGAGTTGTCCAGCTTTTTGCGTTTCTGCTTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTC
TTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCCTCGCACCAGTACGACT
TGTCCATCCCGCTCTCCCCAGCATGCAGCGTGTCATTTCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTG
AACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCGTTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCG
CACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACG