Description :
From Genome Similarity Track
Location :
Scaffold_220:26763- 28207
Sequence
1444 bases(100 bases per row)
CCCAGGTTGGCTCATCATAGCCGACCCACTTGACCTTGAACTTCCGCTGAGTTCTGGAGGTGCTCGTAGAGAGCGGCAACTCGTCGTCCAGGATGGCTTC
GACTTCTTATTCATTCATTGCTTCGTCGGGCTCCCAGCTATCTTCAGGAAGGAGTTCCTCGTCAACGTCGAGACGATCCGACTCGGCTAAGTCGGCTACT
AGCCTAGTTGTCGGCCGCTCGCCGAGTCCCGTGACCGCTTTCAGACGTGACACATGTATCACAGGGTAGAAACGGTATCCGCTCTTGTCCGGGAGTTCGA
GCTCGTAGGCAAAATCCTCCACCTTCTTCTTCACTCGGAATGGCCCATGCCATCGATGTGGTAACTTCTTGGTCAAGCCAGGTCTGACTCGTTCCATGAA
CAACCAAACTTGGTCACCTTCCTTGAATAGTGACTTCCTCGACTCGGCTAACTCGTCACCTTCCTCAGTCGACTCGACTGCTCTCTCGGGCGAGTTCGCT
GGGGTATCCGTCCCTTCCTCCCCGGCTGGGACAGCTCCCTGCTCGACTCGGCTGAGTCCGTCATTGTGTTTCTTCGCTCTCCGTTTCTTCTCCTTCAACT
GGAACTCGGCCGCAAGCTTCAAAGCCACCTCTCTCTGTCGGTTTGCTTCCCTGCGTCATTCGGCTGCCCCCGTTGAGTCACCTGAGTTGCCCCTGCCGAG
CCTGACTGACTCGGTCATCGCCTTGAGTGTAGACCGAGCGTCCCATCCGTGTACCAGGTAGAACGGGGTCTCCCGCCGAGTCGAGTCTCTCGAATTGTTG
ATGGCATGGACGAGCTTCTCGGCTACATCATCCCAGTCGGCTTGGAGAGGGTCTTCCACGTACACACGCACAGTCTGGATCATGGTCTTCACTGAGCGTT
CTTGCTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTCGCTCTCGACTTGGACTGCATCATCTCCGAGAACTTCTGGAACACTTCACTCATGAACCGGGG
ATCTCTGTCGTGGCGTACCAGTGATGGAGCTCCAAACCTCCGGAACACCTTCTCTTCGAAGGCCTTCGCTTCCTCAAGTGCCCCAGTCTCACTCATTGCC
TTAGCAATCACGAAACCGGTGAAGTGGTCTTGAAACAACAGCAGTGCAGTGTTGCCCCGCCGAGTCTTCGGCAGTGGTATGACAAAGTCCATCGATACCA
CGTGGAACGGTCGCTCAGACACTACGTTGCCAGGTGAATAGCCCTTCAGGTGTGGTTTGCTCTTACTGGTACTGCAGTCTTCGCACGCTTGGACATGTTT
GACCACGTCTGCGTACAACCCAATCCAGTAGTAGTCGGCTCTGACCCTGTGGTATGTCCGCACAATCCCTTGGTGGCCTCCCTCGATGGAGTTGTGGCAG
TTCTGCAGGACCTCGTCTATCATGGTCGTCGGAACCACCAGTCG