Description :
From Genome Similarity Track
Location :
Scaffold_1066:2676- 3741
Transcript NameFunction/comments
g9949.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
AGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGAGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACC
ACGTGAGACGATCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGGTAGACAAGCGAA
GGCGAAGCTTGCGAGCTGTAGCGGGGTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGA
AGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCTACT
GTAAAATATACTGATATAAAACATAAGCCTGTCATAGCAAAAACAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCA
CCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCTG
TCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCA
ATACTATAATTCGAGGCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGGACTACACCACATCGGAACTAGCCG
AATGAAATCGCTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTC
TCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAA
CATGCGTGTTCGCACGGCTGCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACC