Description :
From Genome Similarity Track
Location :
Scaffold_31:267590- 269012
Transcript NameFunction/comments
Hyaar_Emoy2804746hypothetical protein

Sequence
1422 bases(100 bases per row)
CCAATGTACCGTCCATAACTTCACGTGCGTTGGTGCAAGTATGACATTCTTGCCACTGACCTGTGGAGTGAAAGCCGACAACCGTTCAATTTGTTTTGCA
TTCAAGAACGGCAATCATTTTGTTGCGCTAAGGATTGATAAAAATTTCCCAGCTCCACCTGTGGTCGCGTACTGGCGTCAACTCGCTTATCCTGTGGCGC
AGTCATGGGCCGGATCTGTCCAGGAAAACCTTCGTTTGTGGATGGCCACTAAGCATGCTCCTACCATTACCACAGTAGATTTGGTTGGTGAAGAAGATGG
TTCTGGTAGTGAAGAAGAGGAGGAAGACAGGGATCTAGTTACATTAAGACCCAAGGCAACATAAATTTATTTTTGTTCATGTCGGACGTTAATCATTATT
CATTTGTTGCATTCTTGCTTTTCGCCTTACATTCTTTAATTTTGTTTTGGTCATTCTTGGCCATTGGTGCTGTCACGTCGTTTGTTTCTGATGTGAGTTT
TGGATCTGAGTCATCTGATTGGTCAGAAATAGGGGGGGTGGTACACATAACAAAAGGGTGTGTACGGATAACACTGGCCTTAAAACAAATGGGGCCCCAA
ATTGTGGCGCGCACCTAGTGCAGTGCAATTCCCTCTAAGTCCACGCAATCGGTTGCGGGTTCGAATCTTGCCTAAGCAAAAATCGTGACTTGAATCATGT
ATGCAAAGGCCAGTTTGTGTCATGACGGAGGCGTGTGTGTGTTGCAGCATGCTACGCTACTGTCATGGGTGGAAATCACACGGCCAGTTACTGAAGTAGA
TGGAAGTAAAAATATAGTAACCCTGAAGTACACGATAAATCAGTGGCTGCAGGGAGCTCATAATCGAATTTGCCGAGACGAGAACGGGCAGAAGATGAGA
GCCGATCAAGCGGAAAGCAATACAACAGAGGAGTCAGAGGCGGGGATGTAAAGATGGTGAAGGTTGTTGGGGAATGCGTAAGCGAACCCCGCAGTCACTA
CCAATTTCACCTACCAAACCTGGCGACTCCGGTGGAGCTAGACGTCCGGAAGCCGTGACGTTGGAAAGTCCGAACGCCAAACCCGACGGTACGCTACGGG
TAATTCAATCAATGAGGGGTAAATAACTTAACTTAGCCGAGGATCATTCAGGTGAGTCCATCGAAGACGACTCCGTGGAAACCCGGAATGGACAAAGGTA
CGATGACAAAAGCTCGACCAGGCCTGGTTGTGTAAACGAACCTTCCCGTGAGACAAAACCAATCAGTTAATTCATTCAAATGGAGAGATTATGAAACCGT
GTAGAGCCAGCTCCAACAGGTGGCGCATAGAACGAAGATGGGAGTTCGCCAGGGTGCATAATTGATAGAGGTGAAGAGCAACGTAATATCGAGCACGTAG
GATCACCGATTCACCGTTGGAC