Description :
From Genome Similarity Track
Location :
Scaffold_1:2675561- 2680151
Transcript NameFunction/comments
Phyin_T30-4PITG_00508Putative uncharacterized protein
Phyin_T30-4PITG_00509Putative uncharacterized protein

Sequence
4590 bases(100 bases per row)
ATGGCGCTCGACGACGACGATGGTGGCCTCTCAAGACTCCGGACGCCGCCATCGACGCAGTTACAGCTAGCGGTGCAGCACAACCGATACAGACAGCTCC
TGCGCACGTTCCTCTCGTGGAAACGGCATGCGCAGACGCAGCGTGAGCGACGAAAAGTACGTAAACGAACATTTGTACAGTTGTATAAAACGCAGCTGAT
ATTTGTCCGTATTGTAAACAGCGAGTCGCCACTGCTTGTCTTGTGGGCTCCATCTTCTGTCAGCGAGAATACTGGTCGAGATGGAGGGCTTTTGTGGCCG
TGAGACGTCAACTAAAGCTGGAGGAAGGACGGGAACACGAAAAGGAATCACTACAGGAGAAAGATCTGGACAACGGCGACTGTATTCGTTTTGATAAACA
AGTAACGAGTGCAGCGTTAACTTCCGATGGAGGAGACAGTGACTACGACATAAGCAACATTGCGGTTCTGCGACAGCACTTTGATGTACGCACGCAGCCA
TGGTCGACCCGACGAGTGTTTTTGTCTTTTGACACAATTGATTTTGTATTTGTGCAGAGATGGAGACTTGCAAGCACAAAAAATGGCAAGGGTTCTGCAA
AATATTCCAAAGGGGTGGCACGGGTGCGTTCGCTGCTTGCAATTCGACGTTGGAAAGGTTTTATGAAGATGAAGAAAGACCGAGATGCTCTACAACAGCG
AGCCTACTTCTTTCTGTATTACTGGCTGCTCAAGCGTTCGTTGAACCAGCTCGGTCGCTATACACTAGTCAAGAAACGAGACCGTCTGCTGACTGTCAAA
ATCATGAAAGCGAATCGACACCGCATACTGATAAAAACAATGCAAAACTGGCGACTGCGACTACAGCTGCTTCGAGTATTTACGCTCTGGAAAAGTTATG
TGCGGCGGCGACATCAACAGGCACTTCTGTACGGACCAATTGCTGAGGCGCTGAAGCACAAGACGCACCATCGTCTTCTCCTATTCATGTTTGCTATTTG
GGAGAAGAAACATGCACAAACGCAAGCACAGCATGCCCTTATTCGTATTGTTGACCGTCATTTGTACCGGAAAATATGTGAAAGAGCGTGGAAAACGTGG
AAAACCAAGGCACATCAGCTTACTCAAGTGGAGTCTTGTCAGCGTCGCTATCAAGAGCGATCACTGCGGCGAGTATGGAATGCGTGGAGTACTCGAACAC
GAGAAAAAGAATTGCGCGAACAGCAAAGACGTCGAGCCGTGCGTCACTATTATTTGGCACTTTTACGTAAGGGATTCCATGGATTTCGAGCGTGGCATGC
TGAGCGACAACTTGCGTTAAACCGAGTAGATACTATGCAAGACGCAGCAGATTTCAGGATGCTGGCGCTAACTTTCTCACGTTGGGATCACTATACTAGC
GAGAGAAAGCTGCAAGCGCACAAGAGTGAGCGCGCTACGCGTCATTATGACTCTCGGCTGCTAAAACACGTTTGGTCAAAAGGGTTTCAGCGCTTTTATT
CCAGAGCATTGTCAAAGAAAAGAATGCTGCGAGCGGCAAAGGATCACAACTACACTCGAACAGTGAGGCGTAGCTTTGATACATGGAAGTATTTGTGGCA
AGCTGAGCGCAATCGTGGCCAAGTTTTGGACAAGAAGGTGCGAGAATTTTTGGGCGAAAAAGAACGAGTTATCAAGGGGAAATGCTTGGAGAACTGGTCA
GAGTTTGCTCGCGCGAAAGCAGCCAGAAGGATCGTAAATGCTCAAGTCCGGGGCCAAGCACAGCGACGAACTCTGCAAAAGTATTTGTCACATTGGATAA
CGTTTGTCTCTGTTCTACGGTGGAAGCAAATAACTCAAGCACGAGCTGAACAGCACTACAAGTCGGTAATCTGGAGGAAATGTTTCGAACGGTGGCGACA
AAATGTAGCTCTGCGTCAGTGCTACCGTAAGAAGACGCGTATGTCGCTGGTGCATTGGAAATTGACGCTGCAACGCAAAGCATTTGACGGGTGGAAGCAG
TATTTAAATCTCAAGAGGATGAAGCAGCATCGTATCCATGAAGCGCTTGAGTTTCGCCACGAGCAGTTTGTACGTCAAGGTTTGCGTCATTGGATGACAG
CTGCTCTGTCTTTGCAAGAGCAGCGTGAACAGCAAGTGGCGCGTACTCAAGCAAGCAACACGACGCATGTTTGGCGTAAGGTTGCAGCGATAGCTCGACA
CTGGCGTTACCTCGCTATTCGAAGGCGAGGTCTAAAGGAAAAGGGACAATCTTTAGACATGAGAGGTGCACCGCGACGAGTTCAAGAAGAGATGTACTGG
CCATCTGAGCATCAACAAATAGGACGCACACAACAAAAACAAACCTCAGTGCCACAATGGAGGAAGATCACTTTCGCAGAGAATGGTGGGAGCTCGAACT
GGACGAAGGAGAGATCTCCGCTATCAGAATTCGTATTGCTGCCAAGGAACCGACCACAACCTCGAAGACCAGTCGAAGTTCTCTTGCCGTTAGAAGCAGA
AAACTTACCAAGACCCGACGAGAACACGAACATGCACGAAGCTCTACGATGTGGCTTTGACTTTCCAGCTGAACCATTTGTACCGCTAAACCTGCCGTCG
AAAAATGTGGTCGAGCCAGCCAATTCTCTTCGAAAACGTCCATCTAACGCTCCAGCGCCTGTGAGAGAGCACAGTGCACACCGAAATCCATCCCCTGCTC
CCCCAATAATGCCACCAAGGGATAATATTGATGATCTGGGTCTGCCGGATACAACAGCAAGACAATTAGACGTGTTGGAACGACGATTATTGACACTGAG
TCAGAGAAAAAGAGAGTGGAAGGCTTCTCAGCAACAACTCGAGGCATTACGTGAAGAAGCTGAGTCAAATCCAAGTCTAATGCCGAATGTTCGGGCAATG
GAGGAGCAACACGCGATTCGTACAAAGCGGTGGTTTCACACAAAAGAGCGAATTCGTTCTCTAGCGTCCGAGATCCAACACTTGAGAAGAGTTCTGCAGC
GATAGTCCGTGAAGAAGATACACACCAACGTCTTATCGTAGTACGGTTTCATACTCAGTTATGAGTGTGGCGGTTGCATCAAATGCAGCCTCGAAGTCGG
CATCCTCCATTCCATGTTGCTTGTACCAGTGCACATAGGCTCCTGCGTGGAATTGGCGCTGAGCTCGTTCGAGAAAGCGTTTCGTGGTCGTCAAAAAGTG
GCCATTATTCACGCAGATCGTTGCAGACGCGTGGGCTTGTAATGACGGAAATGGTGCACGTCTTGAGTAGACTATCGAGGCTTGCGGCATCGTCGCTAGC
CATGGCGTAGAAGGAAATGCACTATGTACGATCTGGCCCAGCTTTTCAGTAAAACGACCAGCATCCTTTGGCCCAGGATTGAAGCCGCGAATTACTGTAC
TTGATGCAATGGTTGCGCGTGAATGCCGTGGGAAGGATGCGACGGTCTGCTGCACTAAACTCTCCAGCATAGCTAGAGACATGTCGAAGTCTGCAACATG
TTCGTGTCGACGCGACAGCAAACGTGATTGTGCGATCACCGGAGCGTGAAACAAGGTGGCTGACGAGGCCGTTTTTGCTAATGAAGGCTGGGAAGGACGT
TTGCAGCGTGAACCTGATCCAACACGGTCTCTATATACGCCGGAACGGACGTCAAGTATCTTGGCTACAGGCATGGGACAAACATCATGCAACAATTTGC
CAAAATCGAAGGGTCGAACAGCGCTTGAGTCTCCTATTGCCACTGGGAACAACAGCCCCGCCAGATCTGCAGCAGCCATATTGTTCACTTCTTTTAGCGA
TACTCGCTGATTATCATCGCTTCCCAGCTTTTCCTGGGCCACCGCTTTCCAGTAACTTGCTGTTCGCAATAACTCGTCATTGTCCTTATAGATTACAGCG
TCTGCAACCTCTTGCAGCCATTTCAACGTCAACACCGTATTGTAGTTTTGAAGAGGTGTATCTCCGCGAGCGCATGACGGTGCCACTGACGCAGTCACTA
TGTAATTCTTCGGATACGTGTCCCTCATGCTTTCCAGCACTCGACAGCCTAAGCCAGACCCTGTTCCTCCACCTAGAGAATGCATCACAACACTGCCTTG
ATAGCAGTCTATACCCTCAATTTCTCGTTGTAGTGAGTCCATGACAAGCTCCACCATTTCTTTGCGATCATCCAGAGCCAGCGATGTGAAGGATGGAGCT
GGAGCCTTCGACCTCGGTCCATGGTATCCCATGGCCCAATTGTTGCCTCGTCCCGCCTGCTCAATGTGCATATGAGCGGGCTGAAAAGCGACAGCACAAT
CACTGACCTCTTTACATACAGCTCGAACGACTTTAGGCTCCGAGTCCGCAAGAATACAACGTGCAGCTCCAGTTGACGGATGAAACAGGTGTCTGGACAA
AGATACTACCTTTTTGGAGCCGTTAACTGCAGCAGTGGAATCTCTAGAGGTGCAGCGGAGCTGCCAGTGTGCACCAGCGTCACCCTGAGTGCGATAATCG
CCTTGAGCTTCTCCCGAAGAAGCGGCCAAGCGCCAGTACGCGGCGCCCAACTGATTGCCACATTGCCCCACGTGCACGTGTACGCTCATG