Description :
From Genome Similarity Track
Location :
Scaffold_289:26750- 29933
Sequence
3183 bases(100 bases per row)
TCGATGGCGTGACAGGTCACGTAAATGAAGAAGTCGGCCTTGCAGACCTCCCATCGTTAATTGACCTGTTGGAGCTAGACGAAATGTCTGTAGATCAGTT
TTGTCTGGCCTTAAAGGCAGGCGACTTATCCGATATGGTTGACCTTCGACCCGATGATGAGTTGAACTTCTCTTCCCTCTTGGATAATACGGTCCTTGAA
AGTACAAAGGCGGCACTCAGTGCACGAAGTGGATCATCCATTCTAAAGAATCCTTCAGATCCCTACTACTCTTTGCTTAAGGATTTTCAAGACGTGGTAT
ATCCATAATCCACCGTCTGTCTACCTCCAATAGGGGTGTACGTCATGAAATTGACTTGGTTCCTGGAACCAAATACTGCGTTATACGGCAGTGGCCTTTA
CCAAAAAAATAATGTGACGTCATCGACGAGTTTTTCAGTGCTAAGCACGCGGTGGGAACGGTTCGTGAGAGTAAGGCTCCTCAGTCTACACCGACATTTT
GTTTCAGAAAACCGAATGGATAGTGGCGTATTGTGCATGCTTATAACAAGCTCGATGCAGCCGCTATACCGGCACAAACGCCAATTCCTAGGAAATGTGT
TCTTCAGAACAACATGGCAGGGTGTACAATGTACAGTGCACTTGAACTGGTCGATGGGTATTACCAACTGCTATGCGAGCTCGTGATATCCCGCTTACAG
CGGTTAGTAACCAAGTGGTATGCTTTGGAATTGGCTGGTTATGCCCCAGAGGCTTTCAAATGCCCCGGCCACATTCAATCGTCTGGTGACACAAGTGTTT
CGCCCTCATTGAGCTCATGCACAAACATACTTTGACGACATATTCGTTCATAGTCTTGCAGAACAAGGCTGGTCAGACGTGGATGATCACATCAACCACT
TACGAGCTGTGCTCGAGTGCATGCTCACTAATAAGCTGTATGATAATGCGTCACAATGCATCTTTCACGCGGACGAGATCCCATTTTTGAGATACTTCAT
TGGGAAACGAGGTCTTCGGGCAGATCTTGCAAAGGTGAATGCTATAGTGGATTGGCCGGTTTCAAAGAACCAAAAGGATTTCTGCAAGTGGCTTAGCCTC
GCCAATCACATAAATAAGTATAGCGAGAATTACGCTGATATGACTCGGCCGTTGTCCAATCTCCCTAAAAAGGATGTGAAGTGGTGCTGGACTAGCACCG
AAGCAGAGTCTTTTACGGCCGTAAAGGAGGGTCTCCTGCATGCCTAGACTTTGGCTTTACCAGACTCTGATCGGCCTTTCAGTGTCGTCTGTGACGCTTC
TGATTTTGCCATTGGCTGTGCTCTGATACAAACGGATGTTGATGGACGCGAGCGTGTCCTCGTTTTTGTGAAGTGGTGCTGGACTAGCACCGAAGCAGAG
TCTTTTACGGCCGTAAAGGAGGGTCTCCTGCATGCCTAGACTTTGGCTTTACCAGACTCTGATCGGCCTTTCAGTGTCGTCTGTGACGCTTCTGATTTTG
CCATTGGCTGTGCTCTGATACAAACGGATGTTGATGGACGCGAGCGTGTCATCGTTTTTGAAAGCTGACGAAAAGCAGTATTTAGTTCATGACAAGGAGC
TACTTGCTATGAAGTATGCTCCTGTCACATTCAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTAGTATATACCGATCATGCGTCGTTATGCACTGCGGC
TCAGTCGCCTCACCGCTCGCAGAGGATGGCCCGTTGGCTTTCATTCTTTGCAAAATATAACTTCGAGGTGAAGTATAAGCCGGGAAAGCAAAATACTTTG
GCAGATGCGTTGTCACGCCTGTCTGATTATGAGCTCGATCATGTAACGACTCTGTAGTCGTCATTTACGGATTTAATACGTGCGCCCTTTGCCAAGGATG
ATCAATGTGTAGCTTTTCTACGCGCTCTTGGCAGCGATGAGTTTAGAGACTCGGACACTAAATTGTCGGCATGATCGCGTGCGGGGCTACATCGGTATTC
CATCTATAACGGCTTGTTGTGCTATTGCACGGATGCGGAGGATACCCCGCGCATCTAGTTCCTCATGATGAATAACTTAAGTATCCCATTCTCTATGAGG
TGCATGAAGCTGCGACTACCGGTCATCTCAGTCGTGAGAAGACCTACAGCTGAGTTAGCCAGTGTTATTGGTGACTTAAACTCTATAAGTGGGTAAGCAC
TTATGTGCACAAATGTGAGACGTGCCCACGGATCAAACCCTCGGCACATGCGACTGCGCTGCTGGCTAGTTTGCCAGTACCCTCTAAGTGCTGGGAGTCA
TCAGCATGGACTTTGTGTTTGACCAGCCGAAGGACTCTGATGATAGCACGGGTATTGTAGTCTTTGTCGAATGTTTGATTAAGATGTCTCACTTAACTGC
TGTGCCAGAGTCCATTTATGGTAAGGGTACAGCTTCGCTGTTCATTGATCGGGTGTTTCGCCAGCACGGTCTACCACTGGCAATTGTCGCTGACCGCGAT
CCTCGTTTCACGGGTAAGTTTCGGAAGTCGGGTTTAAAGGTGCTCGGCACCAGGTTGGACGTGTCTACGTCGGATCATCCGCAGACCGATGGCCTAACCG
AGCGCGTTAATCGCGTTCTCGGTGATGTCTTACGCAGAGTGTGCTCTGTCACACCTCGGCGTTAGAGCTAAATGCTCCTTATTGTTGAGTTCGCCATGAA
CAATGCCGTTCATGCCTCGACAGGCTATGCTACGTTCTACATGAATGGCGCCTCACACACCCACGCGTTCCGTTGACGCTACAACTACGTGTCTCAGGGC
TTGGTGGGGAGAGTAGCCGATCGGCTTGCTGATATCATCCCTGCTATTGTTCAAAAACAGATTAGCGCATTCCTTGCAAAGCGATTAAGTCTTACGACAT
GTTCGTGACGCGATGGTGGATAGCTAAGACAAACAGAACGAACAAGCAGATGCTAAAAGCAGAAGTTGTATTGAAAGTTATGAGGTCGGTGACCAAGTCT
TACTAAACGTTAAGTACCTACCTACAAATGTAGTATCTGCTGTGTTTAAGACGAAGTTGCGTCCGCGCTTCATAGGACGTTTCGCGGTCGTGGCCAAGAA
GGGCCTTGCGTATACGCTTAACTTGCCGCAAAAAATTGCGTCCACCCTGTGTTTTACGTTGGCCTCCTTAAGCCGTATCGGGA