Description :
From Genome Similarity Track
Location :
Scaffold_39:2675- 3874
Transcript NameFunction/comments
Aphas_H257_11409predicted protein

Sequence
1199 bases(100 bases per row)
CGGACTTCCTCGGCGATCTTGTCGCTACTGAACGTCACATGCGACACCATGTGGAACGGGAACATTTCGTTGTTGAAATGGGGCGCCAATTGGTGGAATG
GCGAGCTCAGCGCGATGCTGCTCGGGGCGTTGGGACGCAACGACGCTTCAATGTCCCACTTGATCATGGCCTTGTCGTGGGCTTGCCAGTCCGCCGAGAA
GTTTTTGATCTTGTAGTTAGAGAACACGCTGGCGGAAATCCGCTTGTTTTCAACGATCACGTCGATGTTGGTCAGTTTCTCGCCCGTGACGCCGTCCACA
ATGGTGGCGTTCGGGGTCCACACCGACTTGGCCGACGCTTCAAATGACATCATGCCTTCGTTGATGATCGCTTGCACCAGTTGCAACGTGTTCGTTTGCT
TTGCGCGGAGCTCCAACAGCGCTTCCTCCGTCATGGCTTTGTTGATTGGGCTGCCGTCGCCCCGACGCATAATTTTGGTCTTGAGCTCGCCGTTTTCCTT
CTCCAGCTCGTTGTTCCGGTCTTCCAGAAAGTTCAACCGGTCTTGCTTGCGCTTTCGGCACTTTCGCACGCGTTCGCGGTTCTTTAACCGGCGGCGCGCA
TCGAGTTCGTCTTGCTTGTCCAAGTTGTCCGAGCCCGGGGAGCTTCCGCCATTGGACATGTTGGAAGAGTGGTGGGCGTTGCTCATCGACGACGACATCT
GTTGCTGCTGCTGGCTAGGGTGATGCATCATGGACACTCCGTGGGATGGAGCATTGTGCTGCGCTTGCTGTTGGCTTCGGTTCAAGTATTCGTACATCAG
GGGATGCATCATTTCGGGGTTCATGTGTCCTTGATGTTGATCTTGTTTTGCCGACATGGGTTCTACGGACACGACACAGTAAGACTCTAATGTTTCCGCA
TTGTTGTTGATTTGTACCTTGGTAGCGTCCCTTGAGAATAGATTGGCCTTTTGGGGAATACCCTCCACTTCCCATATGCGGCTGTCCAAATCCCATACCG
CCGAGACCGCCGCTGCGAGGGGACAACGGGAATCCGCCGTGTCGGCTCATGTAATCCCGCGGCGTGAATCCTGTGCGAGGAGTGAATCCTGTTCGCGGCG
TGAGGCCGGTGGAGAAACGCGGCGTCAATCCCGTCTTGAACGCGCCAAGGGGACCGCAGAAGTCTCGCAGATCGTCCATGCCCAAATTGCGCGGTGAGA