Description :
From Genome Similarity Track
Location :
Scaffold_216:26749- 29727
Transcript NameFunction/comments
Phyag_g3586hypothetical protein

Sequence
2978 bases(100 bases per row)
TGGCCATGGGGAGCAGCATCGCGcgtctgctggtgctgggcgtgGCCTTCCACGCGCTATGCATccgcagcatcttcgacatcTACTTCCAGTCACCGGT
GGAGTCCTCAATCTCCAGCGCGAACTACACGTCGTCTCCGCCAGCCAAGcgcgtcatcatcttcacaCTCGACGGTTGTCGCGTTGACAAGCTCTTCAAA
GCCGTCGCAGGCTACGCAGACCACTACGACCTCAACcccagcagcactggcacTGCCGAATACAATTCCGATAGACGCGTGCCTTTCCTGGGCGACGTGA
TGCGTAATCGCGGCAGTTGGGGCGTCTCGCACAACCACGCACCGACCGAAAGTCGCCCGTGTCACGTGGCGTTGACTGCAGGAATGTATGAGGACCCACA
CGCAGTCTATAAGAGCTGGAAACAACACCCAGTACCTTTTGACTCGGTGTTCAATCAGAGCAATAATGCTTTCATATTCGGCAATAAAGACGTCGCTCCG
ATACTGGCCAAACACGCACCTCAAGCTACGGAGGAGCACTATACAGCAAAagaagagatggagatggtACGAGAAGACACGACGCTGTTAGATGTGTGGT
CCTAtcgcaagatgaaggagtTGTTTTCACGAGGAACGCGAGAAAGAGATCTGGAGCTGTACAATAAGTTGCATgacgagaagttggtgatcTATTGCCA
CTTCCTAGGCACTGACTTGACAGGACCGAAATATGGAGCTGATTCGAGAGAGTACTTGGAAAATATTGCAGTGGTGGATGAACTGATTGAGAAGACGCAG
AAAATGATCGAGAACTATTATGCAAATGACTTTCGAACTGCGTATGTGGTTAACGCGGATCATGGCATGGATCTCCGTGGTGACCACGGCGACAATGCGC
CGGCTAAAACACGGACGGCGATTATTGCGTGGGGTGCCGGTGTCCAAGGCCCTGAGAtgacggagacgatggaTAAGAAGAAGTTTGATATTGAGTTACC
GACTAAATCTAGAGCTGAGGTGCAGGCACGCCTGGAAGCACAAGAACATGAAGAACAGACTGCTGTACGCGAATGGGCAACGGTACTTGGCTTAAAGCGC
AAGGATGTTATGCAAGTGGATGTGGCATCACTTATTAGCGCTTTAGTGGGACTTCCGATTCCTCGCAACTCGGTAGGTGTTCTACCGTTTACGTACTTGA
ATAAGGACAAGTATCGTGCAAATGCTATGCGCGCAAATGCACAACAATTGTACCAGCATGCATTACGCAAAGAGGAGGTAAAACGCGCTCACCGAGGGTT
GCTATTTGTTCCGTTCGCTCCTCTCCATCACTGTGTACCAGACCTGGAGGCCCATATCGACGAAGCCCTCAACAGCATTAGTGACGGTAATAGCCACAAA
ATTCATGATGAAGCGCACCTCGTCGTGGAGAAATTGAGCCAAGAGATGATCGGTATTTGTCGGGACGCGATCGTGTATTACCAGACGTACGACTGGTTGT
TTTTGCTGGGGTCGATCGTGCTAGGCTACATCGGCTGGGCCTTAGTCATGACTTTAGCCTATCTACACCCGCAGAAATTTCGGACACGGTGGTTATTGAC
ACGTACGATTGACGTCaagtttgttgctgtggctgggGTGGCATGGTGGTGCTTTCTAGCAGATTCACCGCCTACTTACTATCTGTATGGGCTGTGCCCT
CTTATCTTTTGGAAATTCGTGTGGAGGCATCGGGGCCAACTCCTAGCAGTTTTTCCTGTTGGTAAAGGTTCTGGGTGGCAGTGGGGTGTTCAAATGATGT
TGACCGCCGCTTGTCTGGAGCTTGCTGTTCTCGGCTATCAATACCGACCAGCTTTCAGCTTGCTGTTCGTTTTGCTGGCATTATGGCCGAGAATCGTCGG
TAGCAGACCACTCAAACCGACGGTGACTATGCAAATGACACAACTTTTACGCTGGAGAAAGTTGCTGACGCCGAGTGTTTGCTTGTCAGCAAGTTGTATT
CTCGTCGCTATATTTCCGTGGCTGCCGAGTGAATACGATGAGAACACACtcctcgttcatcttggAGCAGTGTTGGCGGTGATCTTCACTGTTGCCGTGG
TTCGCAACATTTCAGTAGCACACGACCAAGTATACCAATGGAAAAAACTACTGAAATATGGGGGACCTCCAGTGTTGTTGGCGCTTTTGGCTTTGCAGTG
GACATCAGTCTATCTGAAAAACGAAAGCTCTCCTCCGTTTTTCCTGGTGGCGGCAAATTGGATGCTCGCTACGATACCACCATTCTGGATGCTTGTTCGG
CCAAAATGTCAGGGCAAACCCGCAGGCCTGCTCTCGttcaagctggagaacgagcaTGATCTGGAATGCCAGCAAACCGGTCAAGAAATTACGCGTGTGG
TGGTTGTGCGGCTTATCGAAGTGATGCTCGCATTTGTACCAGCTTTTGCACTGCTTAGCTCAGCGTATGAAGTGTTATTTTACGTCGCACTTTGCAGTGC
GCTTGTTAGCTGGTTGAtgctggaggccaagcagaCTGTTACTGGAGGTGTTTCTGTATGCTGTGAGGTGCAACGAGCGCTGATGCTCCTGCTGGTTGTC
CAGATCTCGTTCTTTGGTACAAACAGTGTGGCCAGTATGACAAGTTTCCAGATCCCAGCAACTCGCCGCTTCTTGATAGATTATGCTCCCTCCGTTGCAC
AAGCACTTGTCGTGCTGAAGATTCTGATCCCGTTCGTGGTTGTCGCCTGCGCGTTTAGTCTCATTCTACTGGTACCATCGGGAGCAGTATCAACACGAGA
ACAGGAGCTGCGGGGGAAGTTCTTATGGGTCTCGAGGTATTTCCTCCTGGCAGTAGCATTAGCGGACATTCTGGCGGTGCAGTTCATCTTTCTCGTGAAC
AATGAAGGGAGTTGGAAGCAGATGGGGAACTCCATCGCAGAGTTCTGCATCGTCAATGGCCAGATTGTCCTATTGCCG