Description :
From Genome Similarity Track
Location :
Scaffold_66:267482- 269640
Sequence
2158 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGCGGCAGCTTCATAAGTAGTCCAGGGGCCTTCTGCC
CGAACGGGGTACGGATGATGAATACATACCCGTACCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTG
ATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGA
GAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGACCTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACC
CCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAAC
AACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAAGAAGAGGTCAG
CCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGC
TTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCA
TCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTT
CGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGC
CTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGC
ACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGAACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCATGTTCTACGAACC
GAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGA
GGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCA
CCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCC
TCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTCTGATTGGTCGGTAAACCGAACCTA
AGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGA
ATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACAAACTTA
ACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGT
TTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACA