Description :
From Genome Similarity Track
Location :
Scaffold_6:2674431- 2675732
Transcript NameFunction/comments
Physo_514794retrotransposon nucleocapsid protein

Sequence
1301 bases(100 bases per row)
GAAAAGACCCGCTGGAAACGGATGTGAAGCTCACGGTTGAAGCTGTTGGTGACGCAGTGCAGAAGAAATCCCCAAGTGTTGTCCGCGGACGACATGATGA
CGCGCAAGCTGGCAAGAGTTCAGCTGGAGACGACGACGTTGCGACGTCTGAGCGCGAGAGTACTGTAGTCGAGGCTGATGGAAGCAGCAGTACCAGGGGT
GGAGACAACGCCGTGGAGAAGATGTTCACGATGGGAGTTGTCGACGAGAGTGGTATACAGACCAAATACATCACGCGCAAGAAGTTGCGGAAGTTCTTGA
GAATCAAGACCAAGACGAGCGACGAGCCTGACTTCATGTTGGTGCTGTCGAACGAGACGATCAAGCAAGTTGCACGTTCACTGCAACGCCGAGATCAGCC
CGACAACGTTGGGAGTGCGAAAGCACAACGCTATCTGGAGACAGACTGGGACACCTTCCGAGAGAATCCAGCTTTCAATCTTCTCATGGAGTATAAGGAC
AACGTGTTTCGTCCAGAACTACCCGAAGGTTTACCAGAGAAGCGTGACATCGAACACCGGATCGGTGTGAAGGATCCAAATATGGCGATGTACCGGCAGC
AGTGGCGACAGTCGCCGGAGCAGCTGCGTGAAATCGTGCGCTGGGTCGAAGACATGGTGAAGAAGAAGCTCATTCGACCAAGCATCAGCCCCACGCAGCC
CCAACATTCTGTGTCCGGAAACCAGTTGGCTGGAGAATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGGATCCCGATGACGAGGA
AGGAAGACATCCTTGATGCCATGTCCGGTGCGTACTGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCGGGAAGAAGACATCAA
GTTTACCGCATTCCAAGCGCCGGACGGTCTCTGGGAGTATCTCGTTCTTCCAATGGGAGTTTGCAACGCACCAGCAACGATGCACAGATTGACATCGAAG
CTCTTTCGAGACTTGAAGAACACGAAGTCGTTCTACGATGACATCTATGTTTTCACCAAGTCACCGAAGATCGAGGACCATCTGGACGCACTGCGGAAAA
CACTTGACATCTTGTGTGATAACAAGTTGTACGTCAAGCTCTCCAAGTGTGTCTTCTGCTCCGACGAGATCCCGTGTCTCGGAGATTTCGTAGGGCGAAA
TGGAGTTCGGATGGATCCAGACAAGGTGCAGACCATCAAGGACTGGCCTGTACCACGGACGCAAGAAGAGCTTCACAGCTTCCTTGGCTTGACAGGTTAC
G