Description :
From Genome Similarity Track
Location :
contig_22:267360- 294724
Transcript NameFunction/comments
g5617.t1RAW31845.1 hypothetical protein PC110_g11805 [Phytophthora cactorum
g5618.t1hypothetical protein
g5619.t1hypothetical protein
g5620.t1RAW23875.1 Vacuolar protein sorting-associated protein [Phytophthora cactorum
g5621.t1hypothetical protein
g5622.t1hypothetical protein
g5623.t1hypothetical protein

Sequence
27364 bases(100 bases per row)
CGCGCGCTTCCGCTAGTTTGCGCGGCCATCAGCGATGCTGGTGCGACGCTGAAGGTCGTACCTGATGCGCGAGATGCTCTGCTTTCGATGCATGCCCAGA
ACATCGGTGTCCTGGGCGTATTCGGCCCTGCAGCGACTGGAAAACGCCTGCTACTCAATACTCTGCTGCAGCCTCAAGATGTGGACTTTTCCGCTGCCTC
TGAGGACAGAAACGACGTGCTTCTGTGGCTGTGGGTGCCTCAAGAAGAAGCGCTAAAGACTGATGACAAGGCTCGCGTTGTTCTGGCCGCTGGGGCAGCT
CTGCAGTCTGAGAACGACCAGGACACAGAGAACCACAAGTTGGCGCTGCTACTGCTGCTCTCTTCCGCGCTACTGTACAACACAGACGGAGAGATCAACG
CTGAAGCTATAGGCAGGCTGCAGTGGCTGGAGAAGGTGGCTCAAGTGCTGAGGATCAAGGGCATGCAGGATGAAGAGGCCGTCGGTGAGAGACCTTCGGA
ATGGTTCTGTTTTTCTGCCTTGTGGCGACGCTAACAGCTGATTATCTTTATGTTGTGCTGGTGCAGCTGGTGAGTTCCATGCGCATGCCCCCAAGTTCAT
CTGGTTGACGAGGAACTTCAAGGTCAAGTGGCTCAAAGATACGGAAGGACAGAAGTTGACGTCCATGGAGTATTTTGAGCAGTGTCTCGCGCCGGAGGGA
GGCTACGGAGATGCTGCTACCAAAAGAAACATGATGCGGATGTACTTGGAGTCGTACTTTCCGGTCAGGGATTGTGTGGCGCTGAGCCGTGCAGTGGAAG
GCAACGGAACGGAGATTGTGCCACCTGGGACAGCCCGGAGCGAACTGCGCACACAGTTTGTCGAGGCTGTGGACGAGATTTACGCAAACTATTTGTCGGA
CAAGGCTCAGCGGCTTCCGGCGAAGGAATTGATGGGACATAAGCTGCGCTCCGAGCAGTTTGTAGCTGTCCTTGAGGCGTACGTGGACATGATGAATGCC
AGTCTGCTGCCGACGATGCAGAAGGCGTCGAATGCACTGTTGGAGCAAGAGGTTGCAGAAGCCTTTGAAATAGCGAAGCAAACGTACACAGCAGAAATGC
AGGTGGCGAAGAGTCCCGGTCAAGAAGATGACATGAGTGGCACCGGTGAGAAAGTCCCTAACGCGCGGTGTCTACAGTTGGCTCATTTTCGTGGAATTCA
GGCGGCCATGGCCCATATCCGTGAGGTGCGCTCACACCTCCCGGAGAGACTGCAGAAAACGCTGTTCAAGGACAACTTGGAGGGTTGGGAGGTGCAGGTA
AATCGTGACTTCCAAGAAACTTTGGAGCGTAACACCACGCTGTCAGCAGAAATTTGCTCCAAAATCCTCGAGCGAGTTCTTCCGCAGAACCTCGCGGCTG
TGGCCACTGAGCTCGCTGAACGACCACGAGAAGACTTTTCCGATGGTCTGATTCGACTGTTGACGCAGTACAAGTCAGACTTGCGGAGCGCACTAGATGA
GTACGCTCAGCAAGGCAGCGGACCAGCTGTAGATACCCTCCTAGAGGAGGCGCTGTTGCAGTCTGTACGCGCTTCCATTCAAAAGTGGGGCGCGACGGTG
ATCCACCAGTACCAGAAGCACATGCGGAGTTGGCAGGAGGAGAAAGAGCAACTTGACAAATTGCATGGTCTGGCCAAGGTACAAGGCACTGACACAGCCA
CTTCCGCAAATGAACAAAAGCGGTCTTATGAGCAGCAATTGGCGCAGGCTACGGAGCAGCTCTCTGAACTGCGTCGTGTGCTCCACAGCGAACTCAACAG
CAAAAGAGTGAGCTGGAACGCCTGACTACAGAGATCACAACAATGAACTTGAAGCATGAAGTGCGGGTGAAAAACGCGGAGAGCGACCTTGCTTGGGCTC
GCAGTCGGACGGAAGAGCTGGAAAAGACTTTTGCAGCGGATCGCCAGCGCAAGGAACTAATCTCGGTGGCTGCCGCTCAAGTTTTAGAAAAGCAGCGCAG
CTTTCACAAGGAAGAGCGTTCGTTGCTTGTACAGCAAAAGGAATTGATGGCGCAGATTGTCCAGTTGGAGCGTGAAGTGGTGCAAAAGAAGACAAAGCAC
ACGCAGAAGGTGTTTGCACTGAAAAATGAGCAAGCCAAGAAGCTGGATGGTATGCGACCGAGCAGGCCAAGTTCGAGCGGCAGTTAAAGTCTCAGGCAAA
GAAGGACCTGAGCTCGCTCAAGCTCGCGCACGAAAAGGAGAAGAAAGCCATTCAGGCGGAAGACACTGCTCTGGATAAAGAGCTGGCAGATATTCACGAG
AAGTTGGCGATATTCGTAGCTGAAGAGGATGAGGCTAGAGCCTCCGCTGCTGCTAGTCGCGATTTTTTCAAGTCGATGCCCATGATATCGCTCCCATTGA
TGCAAGCTCCCGCTCCTGCTGCGGGTGAACATCAGCCAGCGAAGCGCTCTGCTAAAGCCACGACGCCGACATACCCGACAATTCCTGTCCGATTCGGTTC
CGCAGATGACACCTCCTCTAGCTCTGCAAGCCCGACCGCTCGTACTGACGTCCCGCAGAGTAGCGATATGTGCAGACAATCCTGAAGAGCCAAGCGCAGC
ATCAACAGTGTGCTAGCGCATAGCTGTCCATTACGCGAAATGGAACTGCGTGCTGTTTGCCAACGACTTTTTACACAGAAATAGCGCTCATGCGCGTTGC
AGTTATTTTGCTGTTGCTTTGCTCGAGGGCGGTACGTAAGGTCTCTGCGTGTACCATTTACCCGTTTTGATCTACCGAGAAGTCTGTGCATGCCTCAAGA
ATGCCCGAGACCCGCTCCTCGCCTGTTGCGTGCTTGGTCGTGACGACATCGGGACGCATACTCTTGCTGTGGGATCAAGATGACACGCTGCCCTTCCGGT
ACCCGCAGCTTGCGATGCTGCTCGCCAGCCTTTTCCACTACGCACAGGCACAATCGTTTGGCCACCTAGAGCTGCAAAATGGCTTCACGGTGTTGGTCTC
TTCACATGTGGAAGCGCAAATCTCGGTCGGTGTCATTTGTGCTACACCGCCAGCATCAGGGCGTAACCACGGTGAATTCTCAGCAGAAGTTGCGCCGCTG
CAATTGGGCCGATTCAAGAGTTTGCTTATCCTGCAGGAGTTCGTGCGGTGCTATCGAGGTGACATCGAGCGGTTAGCAGTGGAGAGTGTCGCGCACGCCA
GACTGATGGCGGAAGAGTATACGCTCACTAGCGCTCTGGGCGGGTTTCAAGACGACTGCGAAGGCACCCTGGACGAATTCGTCGCCTTCCAAAGCGATTT
TGTTACCCCTGTGATGGAAACTACCGCCGAGGCCTCCTGAACTCGATCATGTCGTGGAGTCACGACAGCGCAGTTTTCTTGATGCAGAACTCTTCGGCTA
TTCGAGTGGCGCGGGGTTTTCTCATGAACGCTGAGACCGGAGATGTAGTATTTTCGACACAGCCAGCGTCAGACGCCGACTTCTTCGGACAAGACCCAGT
ATCTCGGAGACTGCATCATCTCCACAAAAGTGCAAGGGTCCAGCAGTTAATAAATCGTGTCGCCAAAGCACTGCACGAAAGCGCTCCTGTCTTGATCCAA
GCCACCCAGGACAACAATTCCGCTAGCGCTACAGTCATTGTGAGATTTACTCACCTGTCGGGTAACGATTTGACCGAGCTCTATGTAGCTCTGCGCGTGT
TACCTGTGAGTCGACCTTGGTGTACCTCTGCACTGTCTTTACGTCTTGTCCCCGCGCTAATACGCGTTCATGCTTGCTGTGGTGTTGTCAATGTGAGCGA
AGACAGGGGTGTTCTCGTCTGGTCGTCTTCTATGGCGACAACGAGCTGTTTCGAGGCCGGCAAAGCGATTGCTCTCTTCAGGGAAACTCACCAGGCTTTG
GCAGCTCACCCAAGCGGTAAACGAATGCTGAACGTTCTGCAAGACCCGTCGGTAGATATAGAGCTGCATGTCGGCTCTGACGGTGCACCGGAAGAAGTCT
GGAGAGCGATGGCTATGTTGGTGCAGCCGTTAACGGTCACGTGGCCGGCCTCCACAACTGCTGCTGTAAAACCCCACTGTGCAGGTACGCACTTTCATGA
CGAACCCATCGATTCGAAGCCATACTCGAAGCTAAGCACGCCTTCAAGATTGCCGCAACACACGGAATAAACCTGGTTAGAAACCCAATCGAGCTCACAT
TGAAAACAAAACTGCAGAACAAGGTCAACGAGTTAGTACTCCGAAGCATTTCATAGATACACCCACGATGCAGATGCTGGCCCTTCGTCGTCGGCGGCAC
TTCTTACATTCTAGTCGAGATACATGTGCTTTGCCAATATCTGGTCGCGAATCCTTCGTGTGAACCACGAGCTGTCGCTCGGAATCGAGGTCTCGCGAAG
CACTTTTCGCCCACCTTCCTCTTCTTCGCAAAGCAGACGCGTGACATCAATAACAACACGGACAGCACCTGCACATTCACGCAAAACGAGGTCAGTCCAT
TGAATCGATCAGCACTGGCCTTCTGAACTGCGTGTCGTACTTGTTACGAATGCTGCCTGCCACGAGCCTCGCTCTGACAGCTTGGGGGCCTCCAGAGCCA
CTGGGATGGCCAAGTCGCGACAGGCCTTCAGCACCAACTCTCTAGTACTGCCTTCCAACACACCCTCACCCGCCGTGAACAGCGCACCATCTTTCACTGC
AACCGTGAGAAGCAAGTAAACAAACCATTACATTAGGACTCGCAACATTTCGTCCCCTTTCAGATTCATACCAACGAAAAGTTCGTGATGAGCCCTTCCA
GCAGCAACCTGTCGCCATTTGGCCCGCGTTTACTCAGCAGCACCTCGTGGATCGGCTCGCCTCGAGTCTCCACCAACTGAGCCACGTGCTTCTCAATGGG
TACGCGGTTTTGGATCCACTGTGTGTGTTTGCATTTGGCCTTCTCACGGCCTTCTCCATACACCAGCACAGTCGATGCCAGGCACTTGGGCTGTGGCATC
GGACAGATATGTACCGCGACGCCGTAGGCCGCAGCGTCCGGCATCGGGTACCAGAGCACAGACAGCATCCCGTCCACCACAGTCTCCATGGACGTCCACT
TTGTCAACACAGTGGCCGTCAATGATCTGTACCATCTTCAACCTGTCCAACTTGACATTTTCTTTGTCGAAGCTGGTCTACCATAGCGAGACCAGTTGAC
AGTCGTTGCAAGTGGAAGGACCATTCTACCAGCTTCTTTGTGGACACATCCTCTGACGCCTTCGCTCTCGCGCACGTGTACACCCCCGCAGGTCGCGACT
GCAGGAACGTCTTGGCAGAAGGGAAGTCCTCACACTCACGCACGACAACCGCCTTCAAGAGTTCTGCATCCGCCGCCACAGCGTCTTGAATCTCCGCCAC
GAGCGCCATCATCCACCTCGAAGTCGAGAGTGTACACTATATGTTGTCTTACGTACGATTGCTCCCCGTCTAAACCGATCTGCGCGCCTGGCCCCACAAT
TCCAGGAGAAGTGAACGGACCACCAGGATCATGCTGCGTCGCTCTTCCCACGTGCTCCTGACCTCTGCGGCGCGCGTCTGCGCCCCTCGCGCGGCTGCGG
CCGTGGCCAACACGCTGCACCTGCAGAGCGCGCGCTTCTCGACTATCTACGACCACCGGACGCCGTTTGAGGTGCGTCTCCAGCGGTGAAATAGCTCAAT
CTGACGCTAATTCACCTCTTTTTGACGCTAATCGCGAACTAGGACGTGAACCGCCACCGCAGCGACGCCGAACAGCGGATCGCCAAGGTGCCAATCGTGG
AGGTGGCCAACAGCGTGGCGGTGTGCGACGGCGGCGGCGGCGCGCTGGGCCACCCCGTGGAGTACATCCAGCTGGACACGCGCAAGCACAACACCCCGCA
GACGTGCAAGTACTGCGGTGTGCGGTACAAGATGAAGGAGGGCTACCACGGCGGTCACTAAGGCTGCAATTGGCAGCTTGAGTTCATTGAGTTGGGGGCT
TTGACAGGAGCTTAGCTGTTGAGGAGCGCTTGCTGACGGACAACCGAGAGGAGCAGCCCAATCAAGTAAATACAACAAAGACGAAGGAGACAAATGAGGG
TGTCGTTGCTGTTGTTGAAGTGCAGACTTGCAACTGTACCACCGAATGTCAGTCACAAGATGCCTTCTGGTTTTACGTGCATTTGACTGTACTCAGTTTG
AAGCATACAGGCAGTTTTCATAGATATTACCGCGATCAAGACGACGGCGAGGTCGATAGCGTATCATCGGAGATGTCCAAGGTGTCCATGTAGCGCACGA
TGGCGCGGTAACGGAACTCGCCTTCTCGGCGCATCTGCCCGTGCTCCATGTTGTCCAAATGATCCTTCACGAGGGTCAGCAGCCCCACCAGGTAGTTGCG
CGTCACCTCGGGCGTCTGCATTTCAAAAAAGTACAAATACTGCACAAAACAAAACAAAAAAGTAGAGTGAGTGTCGGCCAGGCAAGCAATGCAGCCATGG
CAACGTACGGCCTCTAGAATCTCCAGGAAAAGGGGGACTTGGTTTGACGTTGTGTCCTTGATCGCATCCGCAATGCGCAGCGACCGCTGAAGGCATTCCC
TAACGCGTTTGCCATCTTGTTGGGAGGGGTGCTGCAAGACAAAAGAGCGATGAGTACAATCAGTACAGGAACGTCGGCACACTCACATCAGCGGAGACCC
CCTTTTCACTCTTCAACGTCACTCACCCAAAAGAGATGCGCGCAATTCAACACCATCAAAGCTTGTTCGTTCTTCTTGAGAAGTCGGGCGGCGTATTGTG
TGGTCTTGGTAGCGAGAACCTCATAGTTGGCGCTCGAAAGGTTGCGGGTGGAACGCAGTGACGCCACCATCAGTTCTAGTGCGCGCCACTGCTCACGTGC
AAGCGTAATTTGGTCCTCGTACACAATGAAAGCTTGCGTAATGAACTCATACGCGACTGCCTCAAATGCACAGCCATCGGCTACCATAGCACACTGCAGA
AACAAGTGGACGCACGAAACAGACAGCGCATCCTGCTTGGAAGCCAACGCGGTCACCATTTCATGAACGAATTGCAGGACTTCACGCGGAGTTGTAACAA
ACGTCTTGGAATTCCCCACCGAAGCAGCACTCTCTGACTCCGCCTTGGTCTCTTGGCCCTGAGTTTGAGTCTTCTCCTGAGAGTGGGCGGCTAGGTCCCT
AGCGAGAGCCAGCGACTGGTAGATTAACGGTACAAGCGTGAAACGAATACGAAAGACTCCACTCTGCAGAAATGCACGTCGTGCTACAGAAAACACGCGA
AATTTGACGTCAAGGTCATCGTTGGCCACCAGGTGTACAACCTTTGCCAGCGTTTGCTGCTCAGCTTCAAAAATCTCAGCACTCTTTTTTCCCGTTTCCG
CTGTGGTTGTTGGGGGCGGCGATTGCAATTCATTGGGGTCGTCTCGTACTAGTGGCGAAAGCACCTGCAGCAAGAAGTCCATTTGTTGTTCGTTGTGCAC
ACGCTGGTGCCGCGCAAGTAGCACACGATCCACGCTAGGGCTACATCTTTCCACGCGCCTTGCCATGGCATCAGAGCAAGCATCTCACGCAATACTGGCA
CTTGCATCAGATCCTGGATGGAGAGTGCTCTCAGAAGCGTCAGCGCAAGAGACTCCAGCTGTGAAACCACAAGCTGCCGCACTTGCTTATCCTTGTCAAC
ACGCCACGCTGTTCGCTCTCGAAGAAATTCTAAGCATCCTGAAACTATTTGCTGTAGCGCTTCCGTAGTGTCTGAGTTTTTGGCCTTGCTGGTACCCAGC
CACGTGAGAGCGAACGTAGCAAACGTCACGAAAAAGGGCAATACGGACGCCAGGTGTGCGTCACCACCACCTTGGCTTGGAGTTTCTCCACTTCCAACAA
CATACCGCGACGAGCGTAGCAGCAACTTGGAAGCCGTAGCCATCACCTGTTTGAACACTTTGAACCCCTCTTGCTGTTCCTGCTCAAGCTTGGTCCGACC
ATCTACCTCCGCTTCATGTTGTCCTGTGTTGGCCACACTAGCCTGCGTTTCTCGGAATTTGGTAAGGCGCTCAAGAAGCGCTGTCAGGATCAACGCGACG
TCAACGTTTTCCTGCAGTTTGTCCATCGCCTCTAGTAGCCTCTCAAGGTTCTGCAGGTGGAACTCATCCGGGAAGACCTGAATGATGCAGTCCAGCAGAT
ACTGCTGCGCCATGGAATCTTTACATGCAAGCACAACGTCATCCAGGAGTCTAGGCAGCACCTGTTCAGCGTACACACTGCGCGTAACCCCCTCCATCTG
ACTAAGCCGCACAAGACTCGTCCCAACTAGAAGTCGCAGCTCCATCCGCTCCTTCTCTCGAACAGCCAGGGGCCTGGATCCGCCAATCTTTTGGTGCTGC
AGTCGAATCCAAAGCTGGTTTGTCTCCCGTAAATTCTGCAGCAAGAAATCGATGGCGTCGCTGACTGTGCCACCGCCCGATTGCTCGTACACTGATCCTG
TGTCCGGGAGCTTGTCACGGACACTAAGAGACAAATAGTGCCTCAGAAAGAGTCCACGCAGCGGATACTGCACTCCTTTGGTCATCTCCACCAGGTCCGT
CAGCACGTCACGAGCTGGCGCCTCCCTCGATTTGATGTACACCGAGCCCACCGTCACCAGCAAGTAGCTGCACCACAAACAGCCATAAAGTAGTAGTACT
ATACTACATTGGTATCGAGTACTACTAGTATGTGGCTCGTACAGTCTCGGCAGCACGTTACCGCTGCTCTGGACCCGCTCGTACAGCACGCGCATGGAGG
CGCCCGCCTGCTGCTGTTCGTCCACGTAGCTCTCAAAGTGGCGAGCTCGTCCAGCACCTGCATGTCTAGGGAAATAGTACCATACTCTATTAGTGTACAG
CCTGCTGTGTATTGACTAATATGGATGTGAAGTCATTACAGAGCTGGTAGTAGTTCTTGGGGGACAGCAGACTCGTGCGCAGCTCGCGCAGCACTTCGGC
CGCGTGCTTGAGCACCGCCGGCTGGTCCCCGGTGTCCACTGCGCGTTGCATGCGAAAACCCTGGTCGCGCACGGTCTGCAGCGCCTCGCGCAGCAGGTCC
TCCTCGCCCTGCTCGTCCAACACGAAGCCCCCAAGCGCCATCTCGAAGAAAGATTCTTCAAGTGAAATATTACGAAATCAATTCGATTCCCACTTCATAA
TGTAGAATCAAGGACGTTTTGTTTCTTCTAGATGCTATTTACGTTCCCCCAGTAAAACGCGTTTTTAACGCGGCTGATTTATATGAGCAAATAAATTAGA
GCGCAGCCGACATGGCGGGTTCGAAAAAGTGTTCGATAAATAAGTCCTCTCGAGAGCTATGGGGCGTCTAATGCTGTCGCTAGGAGGGGTTGGTACCGGT
ACGCGTCGACGGCGTCTTCTTCCAGGCTCGGCTGGGGTTGGTTGCTACGACTCCGCGGGGATGACTACGGTAGCTTGAATCGGTCTAGATCTTGGGGGCG
AAGACCTTGACCATACGGCTACGCAGGGCGGCGAGCACCACGACCTCCTCGCGCTGGCGCACGCGATGCAGCTCCTTGGTGAGCGCGGCGATCAGACGCT
GCATCCTGCTGTGCGAGGCCTGGTGCATGTGCAGCATGCCGCGGATGTGCGCCAGCAGCTCGAGCTCCTCGTGGCGCTCCTCCTCGAGCTCCTCGAGCTC
CTGCTCGCGGGCGGCCAGGCTGCCGTCGTCATGCGTGGGCGGCAGCACGCGCAGCGCGTCGATATCGAGCTGCAGCTTGGCCATGAGCTCCTCGATCTCC
TGCAGACGCGCCGAGGACTCGCTCACGTCGTCCTCGGACGTGAGCACGGCCTGCTTCTCGGCCGCGACCTCTTCGCGGAGCCGCGCGAGCTGCGTGCGCA
GGCACGCGAGTACATCGTCAGCTTGCGGGCGGCCTTCTCCAGCTGCGCCATGGGCGAGAGGCGCAGACTGTTGCTCTTGGACGGCGCGGACATGGCTCGG
TGGGCTGAATAATCTGTGTGCTGTGTGGGGCGCTGATTGAATAATGGGACGTCTCGACCGTGTCATGCACGCGCAGGACGCGAATGATGTGGCGACGAAC
AGCTGCACCCGCTCGCTGAACATGAACCTGGGCGCGGTGACCCTTCGTTGCCCGACACAGAAACCGCGATTGTAGGGTTTCATAATTTGGGAACCAGCAA
ACAAAAAGTGCGAGTGTCGAGTCTTTCCTGTGCGAACGAGGGCCTGTATTTAATAGCGGAGCTCTTTCAGCGGTTGTGGTTCCCTTGTCAACAACAACGC
TGCGGCGGTGCGCCGTTCGCGGAAGGCGGCGGCAACGGCCGAATCAGCCCGGGAAGTTGCTGCCCGAGCGGGTCGGAGCCGCCTGCAAGGCACTCGTGAC
TCGTGACCGGGCCTCTTGTTCCACCTTGGAATGAATGATAGAGCGCCAGCAAATACATGCACATATATCGCTTGTCAAACCGAGACAGCTGCGGCATCAA
GCTCCTGACTGCCCGCATCACCGATGGTGGACATTGCCGCGGGCATACCCACCAGGCGGGCTTCTCCGTGGCGATGATTTATGACCGATTTCTGCTAACA
GGCAGGGTGCCATGCAGGCACAGCTGGCACCGGGGACGCGCTTGAGGGGAATTACAGATCCGCGCGCAGTGACGCTTTCCGGCCGCAGTTGGAGGTGGCG
CTCGCGCAGTTTGCATCAACGGCCTTGCGGTGGTCAGATGTAAATGAGCCTGCGGCCGAAACTTCAGTCGGCACGACACCAGGAAAAGCCCCGCGGTCCG
AATACATGTAGTTAGCTTCCAGCACGGCTTGAGCTCTGCATCTTGCATGTGCATTGCACTTTGCAACTTGCAGTGCAAGTGGCAACCGCCCGAAAGTGTA
GGGCAGCGTCCGAAACAGTTTTTACAGATCCTAAATCTGATGTGCTAGATCCACAACCCGCAGAATCTGGAAGCCAGATTTGTAGAACGTGTCCCAAACG
GCTCAGGGCTCTACGAAAACCCCGCAGCAGTAGACAGCAGACCTGGGCAAGAGCTCATTCATTGCCAATGAGACATTGGCAACCGTACTCGTCTCGACAA
TGGGTCGTGGCCTTTGTGATGGGCCTGCATGCACGTAGCACACTGGAGGGCGGCACCATTTGCGTCTTGGCTGCTTTCACCAGCGCGACTGGAATCACGA
CAACCCCTGCACAGCGTCGTGCGAAACCAGAAGTCGGAGGGCTCTCTCTCGATCAACGAAGCCCTGTTGTGTTTGTGCCGCACGCAGGACGACGACACCA
CCGGGTGATGGCGAGACAGAGGGAGAGACTGTCACGCCAGAGAGAAGCGAGGAAGACCCGCTGCGATGGGATCGCTGCTGTTGCGGCAACAGGAGGCGAC
ACTGTTAGCTTGAGATCGAGGACGACGACAGCATGAATCAAGCCATCACGGCGAGACTCATCGGAGGGCGGACCTAAATCAGCGGGCGTGCGGCAGTGGG
AGTTCAATTTAATTTAGAACGCCAAACTAGACTCAAACTTTGAAACGGCCCAGAATCTACGGTACAACTTCAGCACCGGCACACGATGAATGCACTCGGC
AGCAAATTGGTAGCAATGGGATTGCACGTCCAAGTGTTGATCGTCTATTGATTCCATAGTAAGTTAAGTCTATCGCTTACAGCCACTTCCACTCCGGGCT
CTCGCGCGTGATGCCGTCCACGAAGTCATCGAACGACTTGCCCGCAGCCTTACACAGTTTGCTCAGCTTGCGGATCTGCTGCTTGCTAAGCGGGCGCAGC
GTCTTGGGGTTCGTGAGCTTGGTGCGCTTCATGGAGCTGTTGACGTTGCTGCCCACCTTCTTCTCCTCCTCGGGCTCCTCGTCGACCACCTTGCGGCCAC
CGCCGGCGCGGTATTCCTTCTCCTGCGCCTCGCCGATGATGGTCAGGCGGCCAGACTCCACCAGCCACTTCTCCGTGCACAGCGAGTTGTAGAACTCTTC
ACTGTGGGAAATCATGATGACACCACCAGCGTACTGGCGGATGCCGTCAGCCAGAGCGCCAAGTGCGGCGCGGTCCAGGTAGTTCGTCGGCTCATCCAGC
ACCAGCAGGTGTGGGCGGTTCCACATCGCAGCAGCGATGACAAGCTTCACCTTCTGACCACCCGACAGACCGCGGATCTTGCCGTGGGTGCCGAACTCAG
CCGGCAGGGCGAAGTCGTCGAGGTGACGTTGGATCTCCTTGGTCGTAAGCGGACGAAGGTCAAGGCCGCCAGCCAGAGTCGCCTGACGGATATCTTCAGC
CTCGGCAAGGGCACCCAGACCCATTTCCTGCAGCTGCTCCAGCGTGTAGCGCTTGTTGTGCTTCTCGTTCAGGCCCACAATCTTACACTCGTACTCGAGC
GTGCCACGCTTGCCCTTGGTACGGGACACGATCTTCTCAACCTGGCCCTGCTTCTTGCCCACGAGGTTCTTCTCCTCCTCCGACTGCTTCAGGTTCACGT
GGTCACCAAGCTCGCGATCAACGCCGTTCTCGCCACCGAAACGCCACTGGAAGTACTCCACAGGGCTGCTCTCAAGGTGCTTCTCAACGTGATGGAACGA
GTGCTGCGCCACGTACGCCAAACGCACAGCGTGGTGCTTCCAGAAGCTGCCCGTGTCGGGAGACGTCTCCTGCACCAGCATCTTGATCAGCGTCGACTTG
CCGGCACCGTTGACACCGATCACAGCCACGCGCGAGGCCAGACACAGCTTTACCGAAACATCAGCGAGCTGAGGCTTGGAGGCACCCGGGTACGTGAAAG
TGGCGTTATCCAGCGTCAAGATACGGCGCGTCATGGAGTTGATGCCCTCCAGACGACCAGGCTCAGGCAGGTTGAAAACCATGTCCGACGACTTCAGCTC
GTAGTAGTGCTTTGCCTCCGGGTGGATGCTCACAAACTCGGACAGCGTCATCGGGTACAGCACCAGCTTCTTCGACTCGTAGTGAAAAATATCCGTGCAC
ACGTTGTCCAGGAAACCGGTGTCGTGAGAAACCAGCAGCACCGTCATCGTCTCGAGCGAGTTCAGGTAGTCCACCAACCACTGCACAGCGTGCACGTCCA
GGTGATTCGTGGGCTCGTCCAGCAGCAGGACGTCGGCGTTGTACAGCATCGCACGAGCCAGCGCCAGCTTCATGCGCCAACCACCGGAGAGCGCATCGAT
CTCGCCGTCCAGCATCTTCTGCGTGAAACCAATCTCCGTCAGGGTCTTCGTAACAGACTCAGGGGTCTGGTGCGAAAGCTCGGGGGCCTTGCACATGGAC
TCCAGCAGACTTCCCTGGCTCTCGACAATGTCCTCATGCTGCACGTACACGGAGCGCAGGGTTTCTGGGAGGCCCTCAATGGCACCAGTAGCCAGGTTGC
GCATGAGCGTGGTCTTACCCACACCGTTCTTGCCGATCAGACCGTAGCGGTGGCCGCGAGTGAGACGCAAGCGCGCGTTACGCAGCAGAATCTTACCACC
GTAAGCCAGCGAGAAATCGAGGTCGCACACATCGTTCGGGTCCGTGGACTTCTCGCGCTCCTCACCCAGACCGCCGCCAGCAGCACGCAGGGCCTCGCAA
ATGTGCTCGGCATCCTTGTCGTGCATGTGCGGCTTCAGGTAATCCATCACGATGGTGCGCCACTCCGATCCACGGTTCTGGGTAGCCAGCTCCGTGCACA
CATCGGTAACGTACTCCAGCGTGAAGTCGTTCAGGCCAGGGTGCGTCGGGCGGTCAAGCGTGTCGGTGAACGCAGTAAAATGTTGTTCTCCAGCTTCTTG
CGAATTTCGATGGGGTCCTCCTCCATCGCCTCTCCATCACCGGCGGCGTGCACAAGATGAGCACGAGCTTCCTTGGCGGCCTCGACGACCTCCTCGTCAA
TCAAGCGGTCGATCGCCGTATCGAGCTGCAGCAGCAGCGGCACGAACTGCATCACATCCGACGGACGGACCACAAGACGGCACATGCTGTCGATAATCTT
CGACGCCTTGCGCTTAAGCGACGAGCTGTGGATGCTCGTATCACGCAGCGCTTTGTGCAGCAGCGGCGCAATCAGGGACAGCGTCGGCGCGTCCACGTTC
GCCACAAAGGTGGTCGCCAGCAGGCTGTCAATGGCCTTCATGGTCTCCTCCGGGCGAGCAATGACACCCACAAGCGTGGGCACAAGCGGCACGACGTCGT
CGTTGTTGATCTTGGAGCACACAGCAATCAGGGCGTCGATAGACGCAGCCTGGACCTGCTTCTTCGTGTCCCAAACGTAGTCGGTGACAATGGGCATGAT
CTCCGGCAGCCAGCCAGACACCTCCTCACTCGCGGCCTCGCTTAGCGCTTTCAACAAGTTGAGGCCAGCAACCTTGCTCTGCCAGTTACGCAACTCCAGC
GCCCTGTAGATTTGCTTGAGAACTGAGTGGATAGCGAGCGGGTTCACCTCCTGCGCGATCGTCTTGGCCAGAGTAGCCGCAGCGTTCTTGACAACGTGCT
CCGAGTCGGCGTGGCGCTGCATAATGTTCGTCAGCTGCTCCACCATGACGGGCTCCATCACCGACGACAGCTCCTCAGTCTTGCACATGGCAATTAGAGC
CAGCAGGGATCCTTCACGGGCCGTAGTTGGCTTGGCCACCAGGAACTTCTTCAGCTCGTCGAGAACATGGATGCCAGCAGTGCTGGCGGGGCCGAGGACC
TCCACGGCCGCCGCAATGTCAGCGGCAGCGGCGTGGCGCTCAGCCTTGGAGGAGAAGGCGGCAACAAGACGCGACAGGACGGCGTCTACTGCGCCGTGAC
GGCGTCCGCGTCCTCGAGCGCACGAAGCGCCTCGCGCTGCTCCTCAGACGCGAGCTCGCGGAACTCGTCACTCTCGTCGGACGAGGACGCGGACGTCTCA
GAAGGCGGGGCGACGGCTTGTGGTGCACGGGCGGCACGGCCACGTTGAGAATGGGGGCCTTGGGCGCCACGAACTGCAGCGACGACGGCGCATGGTTCTC
CTGCTCCAGCACGGAAGGCTTGTTCTGCGTCATGGCGGCCGTCAGCATGGCGTCGGCCGCGGCCTTACGCGCGCGCTGTCCCTTGCCCATGGTGATCTGC
AATAAATGTGTGAGGGGAGTGCGAGGATCGAGTGGGCTTGGTCGCCAATGCGGGAATGAGACACAGCACTAGCGACGGGTTCGCAAGACCACAGCAGCCA
GCCAAATCCACTGAATCTGAAGTTGGCCGTTTCATAACGGCCTGTCGACGTCACTCGTTTGACATTATTGACGGAGGTTGATCAAGCGAAATGCGATCAA
TGCCAATACTGGAGTATAATAGAAGAAGTGTTTGATAGTTATAGTGCATGTTGCTATGTACTCCTGTTGTGGCAACCGACCCTTCGCGACATAGCGACGT
TTTTTAACAAACCGCCGCCAGCCAATCGCTGGCGTTCGCGTCGCTGCTGGGTGGTCCAAGCAACGCGATCCACCGAACATGTCGCGAAGTGCCGACCGCG
GTGCTCGAGCTGGCCAGCGAAGCGACTGGCTTAGCGAGTATGCGCGCTGGTCACAATGTATTACATGCCTAATTAAAGAAGCAGCTCTGCCCCGAGCGTC
CCGTGGCAAAGTCTTATACGGCTGCCAGCGGACCCACAACGGCAGCATTTGGGGCGTTTCAAGTTATTTGCGTTGATAGCGAAACAGCGGTGAAAACTAT
AAAAATAGAGTTGAAAATGGTTGCCGTTCCCCTCGCAAGGAGGGGCACAGAAATTGGTTGAAGCCGCATTTAGTAAACCAACCACACGGTAATCTTTAGT
AAAAGGCGAAAGATTAATACGAATGTAGTTAATTTTGCGGAATGGTTTGCTTCAAAAAACTTTCGTATACCTATATACCACGGGAAACCATACGACCAAA
TGTCTATATTTGATCGGTACTTTACCGGGTTTTGGTTGGAGCTTTGCCTTCGAGAGAAATGTTCGACCTCAAACGAAACGACATGATACATTCCGATGAT
AGCCCTAGCATGAGCTTCATCAGCGCAGTGCGGTCGCTGCATTCCCCTCAACACGAAGATGCGAGGCTACAGCTGGCGTTGTATTGTATTTAGTATAGTG
CCCAGTGGTCCGTGGAAATGAGGGGAAATGAAATACTTTAGATTTGAAAACACGCACTATCAATAGTGTGACGTGAGTCACACAGCACCTTGGGCTTGAG
GAAGTGCTAGGAGTTTACAAACACCAAGTGAACGGCAGTTTACTGATTCCCGGTCTGGGGGAACGGTTGACTTGAACAACGTAGATTCTAGACTGATATT
AGGCGGCTGCGAACAAAATGATACTAATGAACCATTTGGAGTTGTCAAGAATATCACCTCCACCGTTCTTCGTGATGCCACACCTGTTCGATCCACTCAA
GTATTACACGCTCATCGAACCATGCCTTGGTCTGCACCGAAAACGTTTCAACCCACGGCTCACAGCAGTGAAGGTAAATATTCCGTACTTATATTAATAA
AAAATGAGTAGATCCGAGAATGAATAGTGCCATTAGTCTGCATTATGCGTGTCCGTACTTCCTACGATCGAGCAGCTTCAACAGTGTTGACTGTTGGAAG
AGCCCTGATCCACGTGGACCACAGCAAGGACTGCCGTCCGGAGGACCGGTTTGGCCGCCTCCTCCACGATTGGGAAAGCGTTGGTGGCAGGACCCAAGTA
CAGGCATCAAGGACGCCAACGACAGCAAGTACGAGGTAAGCTAGCTAGCATTGTTCAGTCACTTCTCAATATACGACGGGCGTCTGACTACTACCAACAA
CCAACATAGACGTCCCACATATCCCAGACACATCAGCATTGCAAGAGTAGATGGGTCCATACGCTTTCGCTAGTCCGTGTAGACCAGTTTTGCAGCCGAA
AAAAATCTCTCGCACTCGTTCGAGGTGAGTGGAATGAACGTCACATCAGTGTACACCGAGAGCTTCGAGACCTTGCGTCTCTTACACGTGTGCTGGACAA
AAGAGAGGTCCGAAGGTGGCGACGGCTGGGATGTTGCCTGGTCTACGCTGCGAAAGTCGGCACAGGCGACACGCCCGGCGGGACTAAGCGCCTCCCTTCG
TTGTAGCTTGACGATGCCACACGCTAGGGCCGTGTTGTTGACAATAACTGCAGTCGACGAGAGGCAAGACTTCAACTGTGGATAACGCTGAATGACGTGA
CCAAACAGTCGTCGGGTACCCGACAGCGTTAAGGACGAACGTTGCAGCGTCTTGGTGACCCCCTCAAAATCGATGAACACTTAGAGAAGTGCATGCGTCT
TTCAGACTCGGCTCTTCGCAGCAGGAGAGGCTGAATTCCATACTCGACTAGGACGCCAAGCCCCAGGGACTTGAGCGCAGACTCAAGTTTTGTATAGCGT
TGAGCCATGGCATTGGTGTTAGACCAACTGCCATTGCAAATGAGAGGTGGGAGGTCCGTTACACGTCAAAGGATAGCACGCCCCTTGATGGTTCGCAACT
TGATCATCAGGGCATGGATTTTGGAAAGCAGCGTTTCATAGTCGCTCAGGTAGTCATTTACAGCTAAATTAAACCTGTGCGAAGCGCATCCAACCATGGT
AATGGCGCCATCACGACTTCCAATGTATTGGTTCACGCTACCATTGTCAGCGACCATGAAGTGAGCCGCACCCCAGGGCCTGTTGTACCGCGACAGCGTA
TCGGCAATCAGATCAAAGAGGCTTTGAGCCTCAAGATCTTTCTCCACATCGAGAGGGCAGAGCACTACGAGTAGGAAGCGCCGAATGTAGCAGTCAGTGT
CGTCGTAGTAGTCGGAGCCACCCTGAGCTGGGCATGTCAGGATCGTTGAACACGGCGAAAATCGCGATGTAGTGACGACCGCTAAAGGTGCATCCTTCGA
GCACAATACCGAAAGACGGCGGGAGCTCTTCAGCAACCCTAGCCTCGGCAGACTTGAACACGCGCGCGAGGTACAACTTCAACGTTATTTTTGTTAATCG
GAGATAGTGCTGTATTTTTTCTCGTCATCTTGCACTCAACAAAACTGAGGGGTAGACGGTCCACCACGACCCATTCACACCACCGGAAGATGTCACGTGT
CTTCTCATCGATGACACGCAGACGGAGTGCGTTGCGATCCTTGGCGGCTTGAGAGGCATCTTCAATATACGTCGGGTGGTTGGTTCGGAGACGCGTTGTC
AGGTTGGTATAGCCGTGCGCACTCTTGCACGTTTTTGAGCAAGTAGAGCACTTGAAATCCTCCCTCGACTTCTTGGTGAACATGGGGGTGTTGGTGAGAG
TATGGTTATTCGACAGCATAGTGGTAGAGGGTGGGTTGAGGCAGTGAGTTGAATGTAGAAAATCGAATTCTGATCAAATGACAAGATTCAAAAAGTGTAT
TATTCCCCATGTCTAGCCTTGACTTTTCCTACCTCGACTTTGATTGACATTAATTACAACGAGTGGAGGCATGCGATTGGCCTATTTAGGAAGTGACTCA
GTTTTGACTACTATACGGTGCCCAAGTCATGTGGAAAGCCACAACAACGACTGGTCTGTAGTTTACGGAAGTACTGATTGACTGAAATCGATATAGAGGC
ATGTCATTTGATAAAAAAAAAATGTATACCACATTATAATATGGTATAAGAACGCTAAAAAAATATTGTACAAACAAATAAATTATGAAATATTATATAT
GTAATATATTTTAAATTATTATTTTTTACGGATCACAGGCTCACAGTAACGGTTAACCTCATCATGGATTTCATTGTCAGGTTCCCCGGTGAGCTCAAAG
TGCGGCGGCAGCACGCGGCTATCCGCGCGCGCAAGAAGTGCTGCTGTGCAGCGAGAACTGCCCTTATCACCACCATTCGCTGGCACCTTCGTCACCCCAA
CGAAATCCACCGTTGTCTTGGCACCTACGTCGCAGTAGATAGCGGTTTGATCCATATTATAGAGCACGTACGGCGGCGGGGTCGAAGTAGCAGCGTCCAG
GAAGTAATCCATTAGCATCTTCGTACCTCGCATGCAAACGCATCGCGCAGCGCCAGCAATTCGGGGTGTTTCTCTTCTCGGCGCTCACACGTGTTTCGCT
CGATGGCAGGAAGTCCTCGACAGTTTTGATCTTGAATTCAATTGTGTGGGCAAGCTTGATGCGGTGCTGCGGCATTTTACGTATATAAATGGCGTCAGCA
TGCCAGCCTAAACGCCCCACCTAGTTTCGACAAAAATACTGCTGTCCACCCACCTACGTACATAATATCATTGGCCAATCAGAGACAACCGCAAACTTCT
GAAATAATTGGCAGCTGGCAAAAGTGATTTAGAGTAGAGTGCCAGATCTATCAGACTTTTGTGGTAATGGATTTCCGTTTGTTTTTCACGTACCTCTCTG
CCCCATTGATAAAAAACAGCAAGTGAGAGAAAGAGCATCCATGGAAATATGTATTTCGCTAAATTATATAGGTATTGCGCTCTTAGCCAGTAAACCTGAA
CAATGTATGGGCATTTCCAGGTTTCTGCCAGGTATGCAATTCCAGGATTATAAGGTGGTCTTCTTTTTAACTCACAGAAATAGTTTCGTTGTTCCTGCAG
CTCTGTGGTGAATATCACGATAATTATACACTTTCGATCGGTTAGAACAATTTTTAGCTGACGAGAAAAGATCGCTTAGGAGGAGGCGATACGTCTTAGT
GATTGAATTGTTCTTCTGCCCCATTTTTCATCTCACAAGAGTCTAAACCAACTGGTGTACCATGGATTTGTGGTCTTGGGACTGTGACGGGCCATAAGCC
TCGACAGCTATTTCCAGTTGGCGCTGCAGACAAGATGGCTTAGGAACACAGCGTCAAGCCTCTTCCAGATAACAGTCTCCATCCGGCTTTCCCTGCTGGT
TGGCTGAGGAGCAGCCGCAAGCAGACGAGACAAAAGTGATTACTGAGACTACTTCAATATAGTTACTAAGGTTGTCGTTGGGCGGTTGGTCACTTCCACT
TTTGGAGTCCGATAACAACCACCGCCCAACTATCCCTTACGAAAGCCATTCTTTTTAAGATAATTCTCTAAAAATGTAACTTCAGGTCCAGCCACTTCTA
CACCTTTGTATATCCAAAGTGGTGCGAGTCCATAGCAACTCGTTTTTTTACAAATTTGAAAATTGAAAACTGAAACTGAAAAGTGAGATTATTAATCGGG
TTGAATTCCCAGAGCAAAGCGGTAACAAGCCAGAGCAAAGCGGCAATACCTCGCCGGCGACCTCAACGAGTCGGGTTTAAGTGCCGTACTGCATGTCTTC
CATGCGCTCAGCTGCTGCAACAATGCAACGCCATCTTGTTCACCAAACGGAGGTCCATGCAGCTAATGCATTGTCTGGCAGCGCGTTTCAAAATCCGCAT
GCGGCCCTCGGCTATCTGGCCTCGAGGCCGACTTGCCACCAGTTCCTCTCGCGACAACGCCAGGTTCGCCTGGATTTGAGCCTTCAGGACGCTGAAGCAA
CCCTCAATCGGGTTGCACGTCGGGGAGTATGGCGCTAAGCGGAGAAGAACGAGGTCATCGTGCTCGACGACCCGTTCTTCCGTTTGGCTGTGTGCTGGCG
CGTTATCCAGCACAACCACGATCTTCTTGCCCTCGAAATGCTCCTGAAACGTTGGTGAGGCCTTGGCGTTTTCGTAAATCTCGTCAACGAATGAGGCGGT
GACATCCATGCGGATGCTGCCACGTTCTAGGCGGTGGTGAACCAACCCAACCTCCGTCGAGACGGCGCACTGAATCTGGAGATTGGCGCCCTTGGAAGGA
GGCAGCACAACCGTCGCTCGTTCGCCCTTTCGCGCGCGGCCTTGGCTGCGCTTGTAATAAACGTTAAAATTAGTCTCATCGTAGTAAACAACGAAATCGC
CAGCATCCATATGCTTGCGAAGGTCCATAGCAAACTGCTTGCGCTTGGTCTTGTTTACCTCGTTGTTACACGTCTGAGGCTCCACACGGACCTATATCGC
AAAAATATAAGCCATTAGAACATGAGGTGTTAACTGGAGTGCATGGCGACTTACAGCATCTTACCTGCTTCAGCGTGTACAGCATCCCCAGGAGTCTATC
CGATATGGTCGATGTGCTGATGTTCACACCGAAGTCGAACAGAATCATGGCCTTCATGGCACGCAGCGTGTACGTGCAATCGTCGCTAAGGTACCCGTCG
AGAGCTGCCACTATCTCTGGGGTGCACTTGATGCAAGCGCTGCGTGCGCCTCCACGAGGCGATGGCTCTTCACGGCCACTGGCAACGATCCGACGGGCCG
TCGTTGGAGAAATGCCGTTGTGCTTGGCAACAAGCATCCAATCCTCACCAGCACGATGAGCCTCGAGAACACGACCGCGGGAGACAGCAGAGTGTGGCCT
CCTTGGCATGTTTGATGAGGGGGGAACGAGCTCCGCTGAAGACCGGAAATTGAGGAGTGAGATCTAAAACACGAGTGGCAGCGCAATGGACAAGCTTTCC
CGCCCATGCACCTCCAAGAAGCGCACTGAACCACCCGACGTCGTGTTTGGTTTTGGCGCGCAACCGACCGCCACCAATTTGGTTTGCGCAAACACTGCTT
TGCTGTCAACAAGTTCGCAAAGTAACAAAATTCTGCCGAAATTGTTGTGTTACTTTACGCCACTTCACCATATTGCTCTGGACTCGCACCACTTTGGACA
GGCAAAGGTGTAGTTCTGTTCCTCTGTTATTATGGTTCGTTCCAACGGCCCCATGACCCCGGTCTCAGTCCCTTTGTAAGGCCTAGACAACTTCACAGGG
ATACAACCGCATTGTTCAATGTACTCCTCTCCGCGACCAGGGTTTATGAAATTCTGATGAAGTTCGCGCTACTCTACTACCAAGGTTGATGAAATCCGAA
GCCTCCGCTCGTACATATCCAGATTCTGTCGACACAACAATACATAAAAGAGTACGTACTGACACGCTGACGTAGAGCTAAAGCTTCAACGTTATTATAG
ATCCATAGTTACTGTAGGGATGCGACCCTGCCAAAACCAATTCTATAATCTTATTTTCATAATTAAAACATTTCATGTGTCTTGTAGCGGGGCTACACAT
TCGGTTCTTAGTGCAACATGCACTAAGGAATACATTCAGGTTGAACACTTCACAGGGTGGTCCACATTCATAGAAAAAGCGTGTGACTGGTAGAAAGTAA
CATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCC
ATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAG
TAAATTACTCCTACGCTTCCTCATACACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACG
ATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCAT
CGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGC
CATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTC
ACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCC
TCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAA
GGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATG
CAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGG
ACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTG
CACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTG
CTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCC
GAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGATCTCTTCGTTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTC
CAAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTA
CGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGC
ATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACC
ACGTGGTGCATGCGGCCCTCCACAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAGAAGATG
TGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGGTAATGTCGACACACAATTG
GTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCAC
CGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGG
CGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTG
CGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACTGAGTGTCTTGACGCGTACGAGTATTGGT
CTCCAATACAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCA
CGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCC
CTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTAC
TCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCC
ACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACG
TTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAG
ATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCT
CACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCAC
TTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAG
AGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTG
TCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTT
GGACTCGCCACGTATACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCA
GCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGAT
TTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACC
CGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGC
ATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCT
GGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGACCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACAC
CCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCG
TCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATT
GTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTC
TCGCGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCA
GGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGT
ATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGG
TGTTTAGACACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATG
TCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGA
GCGACTGCTTGCCGATGGCGGGGTTCGCCGGTGCATGTCTCGACTGGACACGCACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTAC
TCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAA