Description :
From Genome Similarity Track
Location :
contig_22:267349- 294713
Transcript NameFunction/comments
g5903.t1RAW31845.1 hypothetical protein PC110_g11805 [Phytophthora cactorum
g5904.t1hypothetical protein
g5905.t1hypothetical protein
g5906.t1RAW23875.1 Vacuolar protein sorting-associated protein [Phytophthora cactorum
g5907.t1hypothetical protein
g5908.t1hypothetical protein
g5909.t1hypothetical protein

Sequence
27364 bases(100 bases per row)
GGCAAATTACTCACGAGCAGCTCCATGGTGGCACACTGGCGCGCGCTTCCGCTAGTTTGCGCGGCCATCAGCGATGCTGGTGCGACGCTGAAGGTCGTAC
CTGATGCGCGAGACGCTCTGCTTTCGATGCATGCCCAGAACATCGGTGTCCTGGGCGTATTCGGCCCTGCAGCGACTGGAAAACGCCTGCTACTCAATAC
TCTGCTGCAGCCTCAAGATGTGGACTTTTCCGCTGCCTCTGAGGACAGAAACGACGTGCTTCTGTGGCTGTGGGTGCCTCAAGAAGATGCACTAAAGACT
GATGACAAGGCTCGCGTTGTTCTGGCCGCTGGGGCAGCTCTGCAGTCTGAGAACGACCAGGCCACAGAGAACCACAAGTTGGCGCTGCTACTGCTGCTCT
CTTCCGCGCTACTGTACAACACAGACGGAGAGATCAACGCTGAAGCTATAGGCAGGCTGCAGTGGCTGGAGAAGGTGGCTCAAGTGCTGAGGATCAAGGG
CATGCAGGATGAAGAGGCCGTCGGTGAGAGACCTTCGGAATGGTTCTGTTTTTCTGCCTTGTGGCGACGCTAACAGCTGATTATCTTTATGTTGTGCTGG
TGCAGCTGGTGAGTTCCATGCGCATGCCCCCAAGTTCATCTGGTTGACGAGGAACTTCAAGGTCAAGTGGCTCAAAGATACGGAAGGACAGAAGTTGACG
TCCATGGAGTATTTTGAGCAGTGTCTCGCGCCGGAGGGAGGCTACGGAGATGCTGCTACCAAAAGAAACATGATGCGGATGTACTTGGAGTCGTACTTTC
CGGTCAGGGATTGTGTGGCGCTGAGCCGTGCAGTGGAAGGCAACGGAACGGAGATTGTGCCACCTGGGACAGCCCGGAGCGAACTGCGCACACAGTTTGT
CGAGGCTGTGGACGAGATTTACGCAAACTATTTGTCGGACAAGGCTCAGCGGCTTCCGGCGAAGGAATTGATGGGACATAAGCTGCGCTCCGAGCAGTTT
GTAGCTGTCCTTGAGGCGTACGTGGACATGATGAATGCCAGTCTGCTGCCGACGATGCAGAAGGCGTCGAATGCACTGTTGGAGCAAGAGGTTGCAGAAG
CCTTTGAAATAGCGAACCAAACGTACACAGCAGAAATGCAGGTGGCGAAGAGTCCCGGTCAAGAAGATGACATGAGTGGCACCGGTGAGAAAGTCCCTAA
CGCGCGGTGTCTACAGTTGGCTCATTTTCGTGGAATTCAGGCGGCCATGGCCCATATCCGTGAGGTGCGCTCACACCTCCCGGAGAGACTGCAGAAAACG
CTGTTCAAGGACAACTTGGAGGGTTGGGAAGTGCAGGTAAATCGTGACTTCCAAGAAACTTTGGAGCGTAACACCACGCTGTCAGCAGAAATTTGCTCCA
AAATCCTCGAGCGAGTTCTTCCGCAGAACCTCGCGGCTGTGGCCACTGAGCTCGCTGAACGACCACGAGAAGACTTTTCCGATGGTCTGATTCGACTGTT
GACGCAGTACAAGTCAGACTTGCGGAGCGCACTAGATGAGTACGCTCAGCAAGGCAGCGGACCAGCTGCAGATACCCTCCTAGAGGAGGCGCTGTTGCAG
TCTGTACGCGCTTCCATTCAAAAGTGGGGCGCGACGGTGATCCACCAGTACCAGAAGCACATGCGGAGTTGGCAGGAGGAGAAAGAGCAACTTGACAAAT
TGCATGGTCTGGCCAAGGTACAAGGCACTGACACAGCCACTTCCGCAAATGAACAAAAGCGGTCTTATGAGCAGCAATTGGCGCAGGCTACGGAGCAGCT
CTCTGAACTGCGTCGTGTGCTCCACAGCGAACTCAACAGCAAAAGAGTGAGCTGGAGCGCCTGACTACACAGATCACAACAATGAACTTGAAACATGAAG
TGCGGGTGAAAAACGCGGAGAGCGACCTTGCTTGGGCTCGCAGTCGGACGGAAGAGCTGGAAAAGACTTTTGCAGCGGATCGCCAGCGCAAGGAACTAAT
CTCGGTGGCTGCCGCTCAAGTTTTAGAAAAGCAGCGCAGCTTTCACAAGGAAGAGCGTTCGTTGCTTGTACAGCAAAAGGAATTGATGGCACAGATTGTC
CAGTTGGAACGTGAAGTGGTGCAAAAGAAGACAAAGCACACGCAGAAGGTGTTTGCACTGAAAAATGAGCAAGCCAAGAAGCTGGATGGTATGCGACCGA
GCAGGCCAAGTTCGAGCGGCAGTTAAAGTCTCAGGCAAAGAAGGACCTGAGCTCGCTCAAGCTCGCGCACGAAAAGGAGAAGAAAGCCATTCAGGCGGAA
GACACTGCTCTGGATAAAGAGCTGGCAGATATTCACGAGAAGTTGGCGATATTTGCAGCTGAAGAGGATGAGGCTAGAGCCTCCGCTGCTGCTAGTCGCG
ATTTTTTCAAGTCGATGCCCATGATATCGCTCCCATTGATGCAAGCTCCCGCTCCTGCTGCGGGTGAACATCAGCCAGCGAAGCGCTCTGCTAAAGCCAC
GACGCCGACATACCCGACAATTCCTGTCCGATTCGGTTCCGCAGATGACACCTCCTCTAGCTCTGCAAGCCCGACCGCTCGTACTGACGTCCCGCAGAGT
AGCGATATGTGCAGACAATCCTGACGAGCCAAGCGCAGCATCAACAGTGTGCTAGCGCATAGCTGTCCATTACGCGAAATGGAACTGCGTGCTGTTTGCC
AACGACTTTTTACACAGAAATAGCGCTCATGCGCGTTGCAGTTATTTTGCTGTTGCTTTGCTCGAGGGCGGTACGTAAGGTCTCTGCGTGTACCATTTAC
CCGTTTTGATCTACCGAGAAGTCTGTGCATGCCTCAAGAATGCCCGAGACCCGCTCCTCGCCTGTTGCGTGCTTGGTCGTGACGACATCGGGACGCATAC
TCTTGCTGTGGGATCAAGATGACACGCTGCCCTTCCGGTACCCGCAGCTTGCGATGCTGCTCGCCAGCCTTTTCCACTACGCACAGGCACAATCGTTTGG
CCACCTAGAGCTGCAAAATGGCTTCACGGTGTTGGTCTCTTCACATGTGGAAGCGCAAATCTCGGTCGGTGTCATTTGTGCTACACCGCCAGCATCAGGG
CGTAACCACGGTGAATTCTCAGCAGAAGTTGCGCCGCTGCAATTGGGCCGATTCAAGAGTTTGCTTATCCTGCAGGAGTTCGTGCGGTGCTATCGAGGTG
ACATCGAGCGGTTAGCAGTGGAGAGTGTCGCGCACGCCAGACTGATGGCGGAAGAGTATACGCTCACTAGCGCTCTGGGCGGGTTTCAAGACGACTGCGA
AGGCACCCTGGACGAATTCGTCGCCTTCCAAAGCGATTTTGTTACCCCTGTGATGGAAACTACCGCCGAGGCCTCCTGAACTCGATCATGTCGTGGAGTC
ACGATAGCGCAGTTTTCTTGATGCAGAACTCTTCGGTTATTCGAGTGGCGCGGGGTTTTCTCATGAACGCTGAGACCGGAGATGTAGTATTTTCGACACA
GCCAGCGTCGGACGCCGACTTCTTCGGACAAGACCCAGTATCTCGGAGACTGCATCATCTCCACAAAAGTGCAAGGGTCCAGCAGTTAATAAATCGTGTC
GCCAAAGCACTGCACGAAAGCGCTCCTGTCTTGATCCAAGCCACCCAGGACAACAATTCCGCTAGCGCTACAGTCATTGTGAGATTTACTCACCTGTCGG
GTAACGATTTGACCGAGCTCTACGTAGCTCTGCGCGTGTTACCTGTGAGTCGACCTTGGTGTACCTCTGCACTGTCTTTACGTCTTGTCCCCGCACTAAT
ACGCGTTCATGCTTGCTGTGGTGTTGTCAATGTGAGCGAAGACAGGGGTGTTCTCGTCTGGTCGTCTTCTATGGCGACAACGAGCTGTTTCGAGGCCGAC
AAAGCGATTGCTCTCTTCAGGGAAACTCACCAGGCTTTGGCAGCTCACCCAAGCGGTAAACGAATGCTGAACGTTCTGCAAGACCCGTCGGTAGATATAG
AGCTGCATGTCGGCTCCGACGGTGCACCGGAAGAAGTCTGGACAGCGATGGCTATGTTGGTGCAGCCGTTAACGGTCACGTGGCCGGCCTCCACAACTGC
TGCTGTAAAACCCCACTGTGCAGGTACGCACTTTCATGACGAACCCATCGATTCGAAGCCATACGCGAAGCTAAGCACGCCTTCAAGATTGCCGCAACAC
ACGGAATAAACCTGGTTAGAAACCCAATCGAGCTCACATTGAAAACAAAACTGCAGAACAAGGTCAACGAGTTAGTACTCCGAAGCATTTCATAGATACA
CCCACGATGCAGATGCTGGCCCTTCGTCGTCGGCGGCACTTCTTACATTCTAGTCGAGATACATGCGCTTTGCCAATATCTGGTCGCGAATCCTTCGTGT
GAACCATGAGCTGTCGCTCGGAATCGAGGTCTCGCGAAGCACTTTTCGCCCACCTTCCTCTTCTTCGCAAAGCAGACGCGTGACATCAATAACAACACGG
ACAGCACCTGCACATTCACGCAAAACGAGGTCAGTCCATTGAATCGATCAGCACTGGCCTTCTGAACTGCGTGTCGTACTTGTTACGAATGCTGCCTGCC
ACGAGCCTCGTTCTGACAGCTTGGGGGCCTCCAGAGCCACTGGGATGGCCAAGTCGCGACAGGCCTTCAGCACCAACTCTCTGGTGCTGCCTTCCAACAC
ACCCTCACCCGCCGTGAACAGCGCACCATCTTTCACTGCAACCGTCAGAAGCAAGTAAACAAACCATTACATTAGGACTCGCAACATTTCGTCCCCTTTC
AGATTCATACCAACGAAAAGTTCGTGATGAGCCCTTCCAGCAGCAACCTGTCGCCATTTGGCCCGCGTTTACTCAGCAGCACCTCGTGGATCGGCTCGCC
TCGAGTCTCCACCAACTGAGCCACGTGCTTCTCAATGGGTACGCGGTTTTGGATCCACTGTGTGTGTTTGCATTTGGCCTTCTCACGGCCTTCTCCATAC
ACCAGCACAGTCGATGCCAGGCACTTGGGCTGTGGCATCGGACAGATATGTACCGCGACGCCGTAGGCCGCAGCGTCCGGCATCGGGTACCAGAGCACAG
ACAGCATCCCGTCCACCACAGTCTCCATGGACGTCCACTTTGTCAACACAGTGGCCGTCAATGATCTGTACCATCTTCAACCTGTCCAACTTGACATTTT
CTTTGTCGAAGCTGGTCTACCATAGCGAGACCAGTTGACAGTCGTTGCAAGTGGAAGGACCATTCTACCAGCTTCTTTGTGGACACATCCTCTGACGCCT
TCGCTCTCGCGCACGTGTACACCCCCGCAGGTCGCGACTGCAGGAACATCTTGGCAGAAGGGAAGTCCTCACACTCACGCACGACAACCGCCTTCAAGAG
TTCTGCATCCGCCGCCACAGCGTCTTGAATCTCCGCCACGAGCGCCATCATCCACCTCGAAGTCGAGAGTGTACACTATATGTTGTCTTACGTACGATTG
TTCCCCGTCTAAACCGATCTGCGCGCCTGGCCCCACAATTCCAGGAGAAGTGAACGGACCACCAGGATCATGCTGCGTCGCTCTTCCCACGTGCTCCTGA
CCTCTGCGGCGCGCGTCTGCGCCCCTCGCGCGGCTGCGGCCGTGGCCAACACGCTGCACCTGCAGAGCGCGCGCTTCTCGACTATCTACGACCACCGGAC
GCCGTTTGAGGTGCGTCTCCAGCGGTGAAATAGCTCAATCTGACGCTAATTCACCTCTTTTTGACGCTAATCGCGAACTAGGACGTGAACCGCCACCGCA
GCGACGCCGAACAGCGGATCGCCAAGGTGCCAATCGTGGAGGTGGCCAACAGCGTGGCGGTGTGCGACGGCGGCGGCGGCGCGCTGGGCCACCCCGTGGA
GTACATCCAGCTGGACACGCGCAAGCACAACACCCCGCAGACGTGCAAGTACTGCGGTGTGCGGTACAAGATGAAGGAGGGCTACCACGGCGGTCACTAA
GGCTGCAATTGGCAGCTTGAGTTCATTGAGTTGGGGGCTTTGACAGGAGCTTAGCTGTTGAGGAGCGCTTGCTGACGGACAACCGAGAGAAGCAGCCCAA
TCAAGTAAATACAACAAAGACGAAGGAGACAAATGAGGGTGTCGTTGCTGTTGTTGAAGTGCAGACTTGCAACTGTACCACCGAATGTCAGTCACAAGAT
GCCTTCTGGTTTTACGTGCATTTGACTGTACTCAGTTTGAAGCATACGTGCAGTTTTCATAGATATTACCGCGATCAAGACGACGGCGAGGTCGATAGCG
TATCGTCGGAGATGTCCAAGGTGTCCATGTAGCGCACGATGGCGCGGTAACGGAACTCGCCTTCTCGGCGCATCTGCCCGTGCTCCATGTTGTCCAAATG
ATCCTTCACGAGGGTCAGCAGCCCCACCAGGTAGTTGCGCGTCACCTCGGGCGTCTGCATTTCAAAAAAGTACAAATACTGCACAAAACAAAACAAAAAA
GTAGAGTGAGTGTCGGCCAGGCAAGCAATGCAGCCATGGCAACGTACGGCCTCTAGAATCTCCAGGAAAAGGGGGACTTGGTTTGACGTTGTGTCCTTGA
TCGCATCCGCAATGCGCAGCGACCGCTGAAGGCATTCCCTAACGCGTTTGCCATCTTGTTGGGAGGGGTGCTGCAAGACAAAAGAGCGATGAGTACAATC
AGTACAGGAACGTCGGCACACTCACATCAGCGGAGACCCCCTTTTCACTCTTCAACGTCACTCACCCAAAAGAGATGCGCGCAATTCAACACCATCAAAG
CTTGTTCGTTCTTCTTGAGAAGTCGGGCGGCGTATTGTGTGGTCTTGGTAGCGAGAACCTCATAGTTGGCGCTCGAAAGGTTGCGGGTGGAACGCAGTGA
CGCCACCATCAGTTCTAGTGCGCGCCACTGCTCACGTGCAAGCGTAATTTGGTCCTCGTACACAATGAAAGCTTGCGTAATGAACTCATACGCGACTGCC
TCAAATGCACAGCCATCGGCTACCATAGCACACTGCAGAAACAAGTGGACGCACGAAACAGACAGCGCATCCTGCTTGGAAGCCAACGCGGTCACCATTT
CATGAACGAATTGCAGGACTTCACGCGGAGTTGTAACAAACGTCTTGGAATTCCCCACCGAAGCAGCACTCTCTGACTCCGCCTTGGTCTCTTGGCCCTG
AGTTTGAGTCTTCTCCTGAGAGTGGGCGGCTAGGTCCCTAGCGAGAGCCAGCGACTGGTAGATTAACGGTACAAGCGTGAAACGAATACGAAAGACTCCA
CTCTGCAGAAATGCACGTCGTGCTACAGAAAACACGCGAAATTTGACGTCAAGGTCATCGTTGGCCACCAGGTGTACAACCTTTGCCAGCGTTTGCTGCT
CAGCTTCAAAAATCTCAGCACTCTTTTTTCCCGTTTCCGCTGTGGTTGTTGGGGGCGGCGATTGCAATTCATTGGGGTCGTCTCGTACTAGTGGCGAAAG
CACCTGCAGCAAGAAGTCCATTTGTTGTTCGTTGTGCACACGCTGGTGCCGCGCAAGTAGCACACGATCCACGCTAGGGCTACATCTTTCCACGCGCCTT
GCCATGGCATCAGAGCAAGCATCTCACGCAATACTGGCACTTGCATCAGATCCTGGATGGAGAGTGCTCTCAGAAGCGTCAGCGCAAGAGACTCCAGCTG
TGAAACCACAAGCTGCCGCACTTGCTTATCCTTGTCAACACGCCACGCTGTTCGCTCTCGAAGAAATTCTAAGCATCCTGAAACTATTTGCTGTAGCGCT
TCCGTAGTGTCTGAGTTTTTGGCCTTGCTGGTACCCAGCCACGTGAGAGCGAACGTAGCAAACGTCACGAAAAAGGGCAATACGGACGCCAGGTGTGCGT
CACCACCACCTTGGCTTGGAGTTTCTCCACTTCCAACAACATACCGCGACGAGCGTAGCAGCAACTTGGAAGCCGTAGCCATCACCTGTTTGAACACTTT
GAACCCCTCTTGCTGTTCCTGCTCAAGCTTGGTCCGACCATCTACCTCCGCTTCATGTTGTCCTGTGTTGGCCACACTAGCCTGCGTTTCTCGGAATTTG
GTAAGGCGCTCAAGAAGCGCTGTCAGGATCAACGCGACGTCAACGTTTTCCTGCAGTTTGTCCATCGCCTCTAGTAGCCTCTCAAGGTTCTGCAGGTGGA
ACTCATCCGGGAAGACCTGAATGATGCAGTCCAGCAGATACTGCTGCGCCATGGAATCTTTACATGCAAGCACAACGTCATCCAGGAGTCTAGGCAGCAC
CTGTTCAGCGTACACACTGCGCGTAACCCCCTCCATCTGACTAAGCCGCACAAGACTCGTCCCAACTAGAAGTCGCAGCTCCATCCGCTCCTTCTCTCGA
ACAGCCAGGGGCCTGGATCCGCCAATCTTTTGGTGCTGCAGTCGAATCCAAAGCTGGTTTGTCTCCCGTAAATTCTGCAGCAAGAAATCGATGGCGTCGC
TGACTGTGCCACCGCCCGATTGCTCGTACACTGATCCTGTGTCCGGGAGCTTGTCACGGACACTAAGAGACAAATAGTGCCTCAGAAAGAGTCCACGCAG
CGGATACTGCACTCCTTTGGTCATCTCCACCAGGTCCGTCAGCACGTCACGAGCTGGCGCCTCCCTCGATTTGATGTACACCGAGCCCACCGTCACCAGC
AAGTAGCTGCACCACAAACAGCCATAAAGTAGTAGTACTATACTACATTGGTACCGAGTACTACTAGTATGTGGCTCGTACAGTCTCGGCAGCACGTTAC
CGCTGCTTTGGACCCGCTCGTACAGCACGCGCATGGAGGCGCCCGCCTGCTGCTGTTCGTCCACGTAGCTCTCAAAGTGGCGAGCTCGTCCAGCACCTGC
ATGTCTAGGGAAATAGTACCATACTCTATTAGTGTACAGCCTGCTGTGTATTGACTAATATGGATGTGAAGTCATTACAGAGCTGGTAGTAGTTCTTGGG
GGACAGCAGACTCGTGCGCAGCTCGCGCAGCACTTCGGCCGCGTGCTTGAGCACCGCCGGCTGGTCCCCGGTGTCCACTGCGCGTTGCATGCGAAAACCC
TGGTCGCGCACGGTCTGCAGCGCCTCGCGCAGCAGGTCCTCCTCGCCCTGCTCGTCCAAGACGAAGCCCCCAAGCGCCATCTCGAAGAAAGATTCTTCAA
GTGAAATATTACGAAATCAATTCGATTCCCACTTCATAATGTAGAATCAAGGACGTTTTGTTTCTTCTAGATGCTATTTACGTTCCCCCAGTAAAACGCG
TTTTTAACGCGGCTGATTTATATGAGCAAATAAATTAGAGCGCAGCCGACATGGCGGGTTCGAAAAAGTGTTCGATAAATAAGTCCTCTCGAGAGCTATG
GGGCGTCTAATGCTGTCGCTAGGAGGGGTTGGTACCGGTACGCGTCGACGGCGTCTTCTTCCAGGCTCGGCTGGGGTTGGTTGCTACGACTCCGCGGGGA
TGACTACGGTAGCTTGAATCGGTCTAGATCTTGGGGGCGAAGACCTTGACCATACGGCTACGCAGGGCGGCGAGCACCACGACCTCCTCGCGCTGGCGCA
CGCGATGCAGCTCCTTGGTGAGCGCGGCGATCAGACGCTGCATCCTGCTGTGCGAGGCCTGGTGCATGTGCAGCATGCCGCGGATGTGCGCCAGCAGCTC
GAGCTCCTCGTGGCGCTCCTCCTCGAGCTCCTCGAGCTCCTGCTCGCGGGCGGCCAGGCTGCCGTCGTCATGCGTGGGCGGCAGCACGCGCAGCGCGTCG
ATATCGAGCTGCAGCTTGGCCATGAGCTCCTCGATCTCCTGCAGACGCGCCGAGGACTCGCTCACGTCGTCCTCGGACGTGAGCACGGCCTGCTTCTCGG
CCGCGACCTCTTCGCGGAGCCGCGCGAGCTGCGTGCGCAGGCACGCGAGTACATCGTCAGCTTGCGGGCGGCCTTCTCCAGCTGCGCCATGGGCGAGAGG
CGCAGACTGTTGCTCTTGGACGGCGCGGACATGGCTCGGTGGGCTGAATAATCTGTGTGCTGTGTGGGGCGCTGATTGAATAATGGGACGTCTCGACCGT
GTCATGCACGCGCAGGACGCGAATGATGTGGCGACGAACAGCTGCACCCGCTCGCTGAACATGAACCTGGGCGCGGTGACCCTTCGTTGCCCGACACAGA
AACCGCGATTGTAGGGTTTCATAATTTGGGAACCAGCAAACAAAAAGTGCGAGTGTCGAGTCTTTCCTGTGCGAACGAGGGCCTGTATTTAATAGCGGAG
CTCTTTCAGCGGTTGTGGTTCCCTTGTCAACAACAACGCTGCGGCGGTGCGCCGTTCGCGGAAGGCGGCGGCAACGGCCGAATCAGCCCGGGAAGTTGCT
GCCCGAGCGGGTCGGAGCCGCCTGCAAGGCACTCGTGACTCGTGACCGGGCCTCTTGTTCCACCTTGGAATGAATGATAGAGCGCCAGCAAATACATGCA
CATATATCGCTTGTCAAACCGAGACAGCTGCGGCATCAAGCTCCTGACTGCCCGCATCACCGATGGTGGACATTGCCGCGGGCATACCCACCAGGCGGGC
TTCTCCGTGGCGATGATTTATGACCGATTTCTGCTAACAGGCAGGGTGCCATGCAGGCACAGCTGGCACCGGGGACGCGCTTGAGGGGAATTACAGATCC
GCGCGCAGTGACGCTTTCCGGCCGCAGTTGGAGGTGGCGCTCGCGCAGTTTGCATCAACGGCCTTGCGGTGGTCAGATGTAAATGAGCCTGCGGCCGAAA
CTTCAGTCGGCACGACACCAGGAAAAGCCCCGCGGTCCGAATACATGTAGTTAGCTTCCAGCACGGCTTGAGCTCTGCATCTTGCATGTGCATTGCACTT
TGCAACTTGCAGTGCAAGTGGCAACCGCCCGAAAGTGTAGGGCAGCGTCCGAAACAGTTTTTACAGATCCTAAATCTGATGTGCTAGATCCACAACCCGC
AGAATCTGGAAGCCAGATTTGTAGAACGTGTCCCAAACGGCTCAGGGCTCTACGAAAACCCCGCAGCAGTAGACAGCAGACCTGGGCAAGAGCTCATTCA
TTGCCAATGAGACATTGGCAACCGTACTCGTCTCGACAATGGGTCGTGGCCTTTGTGATGGGCCTGCATGCACGTAGCACACTGGAGGGCGGCACCATTT
GCGTCTTGGCTGCTTTCACCAGCGCGACTGGAATCACGACAACCCCTGCACAGCGTCGTGCGAAACCAGAAGTCGGAGGGCTCTCTCTCGATCAACGAAG
CCCTGTTGTGTTTGTGCCGCACGCAGGACGACGACACCACCGGGTGATGGCGAGACAGAGGGAGAGACTGTCACGCCAGAGAGAAGCGAGGAAGACCCGC
TGCGATGGGATCGCTGCTGTTGCGGCAACAGGAGGCGACACTGTTAGCTTGAGATCGAGGACGACGACAGCATGAATCAAGCCATCACGGCGAGACTCAT
CGGAGGGCGGACCTAAATCAGCGGGCGTGCGGCAGTGGGAGTTCAATTTAATTTAGAACGCCAAACTAGACTCAAACTTTGAAACGGCTCAGAATCTACG
GTACAACTTCAGCACCGGCACACGATGAATGCACTCGGCAGCAAATTGTTAGCAATGGGATTGCACGTCCAAGTGTTGATCGTCTATTGATTCCATAGTA
AGTTAAGTCTATCGCTTACAGCCACTTCCACTCCGGGCTCTCGCGCGTGATGCCGTCCACGAAGTCATCGAACGACTTGCCCGCAGCCTTACACAGTTTG
CTCAGCTTGCGGATCTGCTGCTTGCTAAGCGGGCGCAGCGTCTTGGGGTTCGTGAGCTTGGTGCGCTTCATGGAGCTGTTGACGTTGCTGCCCACCTTCT
TCTCCTCCTCGGGCTCCTCGTCGACCACCTTGCGGCCACCGCCGGCGCGGTATTCCTTCTCCTGCGCCTCGCCGATGATGGTCAGGCGGCCAGACTCCAC
CAGCCACTTCTCCGTGCACAGCGAGTTGTAGAACTCTTCACTGTGGGAAATCATGATGACACCACCAGCGTACTGGCGGATGCCGTCAGCCAGAGCGCCA
AGTGCGGCGCGGTCCAGGTAGTTCGTCGGCTCATCCAGCACCAGCAGGTGCGGGCGGTTCCACATCGCAGCAGCGATGACAAGCTTCACCTTCTGACCAC
CCGACAGGCCGCGGATCTTGCCGTGGGTGCCGAACTCAGCCGGCAGGGCGAAGTCGTCGAGGTGACGTTGGATCTCCTTGGTCGTAAGCGGACGAAGGTC
AAGGCCGCCAGCCAGAGTCGCCTGACGGATATCTTCAGCCTCGGCAAGGGCACCCAGACCCATTTCCTGCAGCTGCTCCAGCGTGTAGCGCTTGTTGTGC
TTCTCGTTCAGGCCCACAATCTTACACTCGTACTCGAGCGTGCCACGCTTGCCCTTGGTACGGGACACGATCTTCTCAACCTGGCCCTGCTTCTTGCCCA
CGAGGTTCTTCTCCTCCTCCGACTGCTTCAGGTTCACGTGGTCACCAAGCTCGCGATCAACGCCGTTCTCGCCACCGAAACGCCACTGGAAGTACTCCAC
AGGGCTGCTCTCAAGGTGCTTCTCAACGTGATGGAACGAGTGCTGCGCCACGTACGCCAAACGCACAGCGTGGTGCTTCCAGAAGCTGCCCGTGTCGGGA
GACGTCTCCTGCACCAGCATCTTGATCAGCGTCGACTTGCCGGCACCGTTGACACCGATCACAGCCACGCGCGAGGCCAGACACAGCTTTACCGAAACAT
CAGCGAGCTGAGGCTTGGAGGCACCCGGGTAGGTAAAAGTGGCGTTATCCAGCGTCAAGATACGGCGCGTCATGGAGTTGATGCCCTCCAGACGACCAGG
CTCAGGCAGGTTGAAAACCATGTCCGACGACTTCAGCTCGTAGTAGTGCTTTGCCTCCGGGTGGATGCTCACAAACTCGGACAGCGTCATCGGGTACAGC
ACCAGCTTCTTCGACTCGTAGTGGAAAATATCCGTGCACACGTTGTCTAGGAAACCGGTGTCGTGAGAAACCAGCAGCACCGTCATCGTCTCGAGCGAGT
TCAGGTAGTCCACCAACCACTGCACAGCGTGCACGTCCAGGTGATTCGTGGGCTCGTCCAGCAGCAGGACGTCGGCGTTGTACAGCATCGCACGAGCCAG
CGCCAGCTTCATGCGCCAACCACCGGAGAGCGCATCGATCTCGCCGTCCAGCATCTTCTGCGTGAAACCAATCTCCGTCAGGGTCTTCGTAACAGACTCA
GGGGTCTGGTGCGAAAGCTCGGGGGCCTTGCACATGGACTCCAGCAGACTTCCCTGGCTCTCGACAATGTCCTCATGCTGCACGTACACGGAGCGCAGGG
TTTCTGGGAGGCCCTCAATGGCACCAGTAGCCAGGTTGCGCATGAGCGTGGTCTTACCCACACCGTTCTTGCCGATCAGACCGTAGCGGTGGCCGCGAGT
GAGACGCAAGCGCGCGTTACGCAGCAGAATCTTACCACCGTAAGCCAGCGAGAAATCGAGGTCGCACACATCGTTCGGGTCCGTGGACTTCTCGCGCTCC
TCACCCAGACCGCCGCCAGCAGCACGCAGGGCCTCGCAAATGTGCTCGGCATCCTTGTCGTGCATGTGCGGCTTCAGGTAATCCATCACGATGGTGCGCC
ACTCCGATCCACGGTTCTGGGTAGCCAGCTCCGTGCACACATCGGTAACGTACTCCAGCGTGAAGTCGTTCAGGCCAGGGTGCGTCGGGCGGTCAAGCGT
GTCGGTGAACGCAGTAAAATGTTGTTCTCCAGCTTCTTGCGAATTTCGATGGGGTCCTCCTCCATCGCCTCTCCATCACCGGCGGCGTGCACAAGATGAG
CACGAGCTTCCTTGGCGGCCTCGACGACCTCCTCGTCAATCAAGCGGTCGATCGCCGTATCGAGCTGCAGCAGCAGCGGCACGAACTGCATCACATCCGA
CGGACGGACCACAAGACGGCACATGCTGTCGATAATCTTCGACGCCTTGCGCTTAAGCGACGAGCTGTGGATGCTCGTATCACGCAGCGCTTTGTGCAGC
AGCGGCGCAATCAGGGACAGCGTCGGCGCGTCCACGTTCGCCACAAAGGTGGTCGCCAGCAGGCTGTCAATGGCCTTCATGGTCTCCTCCGGGCGAGCAA
TGACACCCACAAGCGTGGGCACAAGCGGCACGACGTCGTCGTTGTTGATCTTGGAGCACACAGCAATCAGGGCGTCGATAGACGCAGCCTGGACCTGCTT
CTTCGTGTCCCAAACGTAGTCGGTGACAATGGGCATGATCTCCGGCAGCCAGCCAGACACCTCCTCACTCGCGGCCTCGCTTAGCGCTTTCAACAAGTTG
AGGCCAGCAACCTTGCTCTGCCAGTTACGCAACTCCAGCGCCCTGTAGATTTGCTTGAGAACTGAGTGGATAGCGAGCGGGTTCACCTCCTGCGCGATCG
TCTTGGCCAGAGTAGCCGCAGCGTTCTTGACAACGTGCTCCGAGTCGGCGTGGCGCTGCATAATGTTCGTCAGCTGCTCCACCATGACGGGCTCCATCAC
CGACGACAGCTCCTCACTCTTGCACATGGCAATTAGAGCCAGCAGGGATCCTTCACGGGCCGTAGTTGGCTTGGCCACCAGGAACTTCTTCAGCTCGTCG
AGAACATGGATGCCAGCAGTGCTGGCGGGGCCGAGGACCTCCACGGCCGCCGCAATGTCAGCGGCAGCGGCGTGGCGCTCAGCCTTGGAGGAGAAGGCGG
CAACAAGACGCGACAGGACGGCGTCTACTGCGCCGTGACGGCGTCCGCGTCCTCGAGCGCACGAAGCGCCTCGCGCTGCTCCTCAGACGCGAGCTCGCGG
AACTCGTCACTCTCGTCGGACGAGGATGCGGACGTCTCAGAAGGCGGGGCGACGGCTTGTGGTGTACGGGCGGCACGGCCACGTTGAGAATGGGGGCCTT
GGGCGCCACGAACTGCAGCGACGACGGCGCATGGTTCTCCTGCTCCAGCACGGAAGGCTTGTTCTGCGTCATGGCGGCCGTCAGCATGGCGTCGGCCGCG
GCCTTACGCGCGCGCTGTCCCTTGCCCATGGTGATCTGCAATAAATGTGTGAGGGGAGTGCGAGGATCGAGTGGGCTTGGTCGCCAATGCGGGAATGAGA
CACAGCACTAGCGACGGGTTCGCAAGACCACAGCAGCCAGCCAAATCCACTGAATCTGAAGTTGGCCGTTTCATAACGGCCTGTCGACGTCACTCGTTTG
ACATTATTGACGGAGGTTGATCAAGCGAAATGCGATCAATGCCAATACTGGAGTATAATAGAAGAAGTGTTTGATAGTTATAGTGCATGTTGCTATGTAC
TCCTGTTGTGGCAACCGACCCTTCGCGACATAGCGACGTTTTTTAACAAACCGCCGCCAGCCAATCGCTGGCGTTCGCGTCGCTGCTGGGTGGTCCAAGC
AACGCGATCCACCGAACATGTCGCGAAGTGCCGACCGCGGTGCTCGAGCTGGCCAGCGAAGCGACTGGCTTAGCGAGTATGCGCGCTGCTCACAATGTAT
TACATGCCTAATTAAAGAAGCAGCTCTGCGCCGAGCGTCCCGTGGCAAAGTCTTATACGGCTGCCAGCGGACCCACAACGGCAGTATTTGGGGCGTTTCA
AGTTATTTGGGTTGAGAGCGAAACAGCGGTGAAAACTATAAAAATAGAATTGAAAATGGTTGCCGTTCCCCTCGCAAGGAGGGGCACAGAAATTGGTTGA
AGCCGCATTTAGTAAACCAACCACACGGTAATCTTTAGTAAAAGGCGAAAGATTAATACGAATGTAGTTAATTTTGCGGAATGGTTTGCTTTAAAAAAGC
ATTCGTATACCTATATACCACGGGAAACCATACGACCAAATGTCTATATTGGATCGGTACTTTACCGGGTTTTGGTTGGAGCTTTGCCTTCGAGAGAAAT
GTTCGACCTCAAACGAAACGACATGATACATTCCGATGATAGCCCTAGCATGAGCTTCATCAGCGCAGTGCGGTCGCTGCATTCCCCTCAACACGAAGAT
GCGAGGCTACAGCTGGCGTTGTATTGTATTTAGTATAGTGCCCAGTGGTCCGTGGAAATGAGGGGAAATGAAATACTTTAGATTTGAAAACACGCACTAT
CAATAGTGTGACGTGAGTCACACAGCACCTTGGGCTTGTGTGGAAGTGCTAGGAGTATACAAACACCAAGTGAACGGCAGTTTACTGATTCCCGGTCTGG
GGGAACGGTTGACTTGAACAACGTAGATTCTAGACTGATATTAGGCGGCTGCGAACAAAATGATACTAATGAACCATTTGGAGTTGTCAAGAATATCACC
TCCACCGTTCTTCGTGATGCCACACCTGTTCGATCCACTCAAGTATTACACGCTCATCGAACCATGCCTTGGTCTGCACCGAAAACGTTTCAACCCACGG
CTCACAGCAGTGAAGGTAAATATTCCGTACTTATATTAATAAAAAATGAGTAGATCCGAGAATGAATAGTGCCATTAGTCTGCATTATGCGTGTCCGTAC
TTCCTACGATCGAGCAGCTTCAACAGTGTTGACTGTTGGAAGAGCCCTGATCCACGTGGACCACAGCAAGGACTGCCGTCCGGAGGACCGGTTTGGCCGC
CTCCTCCACGATTGGGAAAGCGTTGGTGGCAGGACCCAAGTACAGGCATCAAGGACGCCAACGACAGCAAGTACGAGGTAAGCTAGCTAGCATTGTTCAG
TCACTTCTCAATATACGACGGGCGTCTGACTACTACCAACAACCAACATAGACGTCCCACATATCCCAGACACATCAGCATTGCAAGAGTAGATGGGTCC
ATACGCTTTCGCTAGTCCGTGTAGACCAGTTTTGCAGCCGAAAAAAATCTCTCGCACTCGTTCGAGGTGAGTGGAATGAACGTCACATCAGTGTACACCG
AGAGCTTCGAGACCTTGCGTCTCTTACACGTGTGCTGGACAAAAGAGAGGTCCGAAGGTGGCGACGGCTGGGATGTTGCCTGGTCTACGCTGCGAAAGTC
GGCACAGGCGACACGCCCCGGCGGGACTAAGCGCCTCCCTTCGTTGTAGCTTGACGATGCCACACGCTAGGGCCGTGTTGTTGACAATAACTGCAGTCGA
CGAGAGGCAAGACTTCAACTGTGGATAACGCTGAATGACGTGACCAAACAGTCGTCGGGTACCCGACAGCGTTAAGGACGAACGTTGCAGCGTCTTGGTG
ACCCCCTCAAAATCGATGAACACTTAGAGAAGTGCATGCGTCTTTCAGACTCGGCTCTTCGCAGCAGGAGAGGCTGAATTCCATACTCGACTAGGACGCC
AAGCCCCAGGGACTTGAGCGCAGACTCAAGTTTTGTATAGCGTTGAGCCATGGCATTGGTGTTAGACCAACTGCCATTGCAAATGAGAGGTGGGAGGTCC
GTTACACGTCAAAGGATAGCACGCCCCTTGATGGTTCGCAACTTGGTCATCAGGGCATGGATTTTGGAAAGCAGCGTTTCATAGTCGCTCAGGTAGTCAT
TTACAGCTAAATTAAACCTGTGCGAAGCGCATCCAACCATGGTAATGGCGCCATCACGACTTCCAATGTATTGGTTCACGCTACCATTGTCAGCGACCAT
GAAGTGAGCCGCACCCCAGGGCCTGTTGTACCGCGACAGCGTATCGGCAATCAGATCAAAGAGGCTTTGAGCCTCAAGATCTTTCTCCACATCGAGAGGG
CAGAGCACTACGAGTAGGAAGCGCCGAATGTAGCAGTCAGTGTCGTCGTAGTAGTCGGAGCCACCCTGAGCTGGGCATGTCAGGATCGTTGAACACGGCG
AAAATCGCGATGTAGTGACGACCGCTAAAGGTGCATCCGTCGACCACAATACCGAAAGACGGCGGGAGCTCTTCAGCAACCCTAGCCTCGGCAGACTTGA
ACACGCGCGCGAGGTACAACTTCAACGTTATTTTTGTTAATCGGAGATAGTGCTGTATTTTTTCTCGTCATCTTGCGCTCGACAAAACTGAGGGGTAGAC
GGTCCACCACGACCCATTCACACCACCGGAAGATGTCACGTGTCTTCTCATCGATGACACGCAGACGGAGTGCGTTGCGATCCTTGGCGGCTTGAGAGGC
ATCTTCAATATACGTCGGGTGGTTGGTTCGGAGACGCGTTGTCAGGTTGGTATAGCCGTGCGCACTCTTGCACGTTTTTGAGCAAGTAGAGCACTTGAAA
TCCTCCCTCGACTTCTTGGTGAACATGGGGGTGTTGGTGAGGGTATGGTTATTCGACGGCATAGTGGTAGAGGGTGGGTTGAGGCAGTGAGTTGAATGTA
GAAAATCGAATTCTGATCAAATGACAAGATTCAAAAAGTGTATTATTCCCCATGTCTAGCCTTGACTTTTCCTACCTCGACTTTGATTGACATTAATTAC
AACGAGTGGAGGCATGCGATTGGCCTATTTAGGAAGTGACTCAGTTTTGACTACTATACGGTGCCCAAGTCATGTGGAAAGCCACAACAACGACTGGTCT
GTAGTTTACGGAAGTACTGATTGACTGAAATCGATATAGAGGCATGTCATTTGATAAAAAAAAAATGTATACCATATTATAATATAGTATAAAAAAGCTA
AAAAAATATTGCACAAACAAATAAATTATGAAATATTATATATGTAATATATTTTAAAGTATTTTTTTTTACGGATCACTGGCTCACAGTAACGGTTAAC
CTCATCATGGATTTCATTGTCAGGTTCCCCGGTGAGCTCAAAGTGCGGCGGCAGCATGTGGCCATCCGCGCACGCAAGAAGTGCTGCTGTGCAGCGAGAA
CTGCCCTTATCACCACCATTCGCTGGCACCCTCGTCACCCCAACGAAATCCACAGTTGTCTTGGCACCTGCGTTGCAATAGATAGCGGTTTGATCCATAT
TATAGAGCACGTACGGCGGCGGGGTCGAAGTAGCAGCGTCCAGGAAGTAATCCATTAGCATCTTCGTACCTCGCATGCAAACGCATCGCGCAGCGCCAGC
AATTCGGGGTGTTTCTCTTCTCGGCGCTCACACGTGTTTCGCTCGATGGCAGGAAGCCCTCGACAGTTTTGATCTTGAATTCAATTGTGTGGGCAAGCTT
GATGCGGTGCTGCGGCATTTTACGGATATATATGGCGTCAGCATGCCAGCCTAAACGCCCCACCTAGTTTCGACAAAAATACTGCTGTCCACCCACCTAC
GTACATAATATCATTGGCCAATCAGAGACAACCGCAAACTTCTGAAAGAATTGGCAACTGGCAAAAGTGATTTAGAGTAGAGTGCCAGATCTATCAGACT
TTTGTGGTAATGGATTTCCGTTTGTTTTTCACGTGCCTCTCTGCCCCATTGATAAAAAACAGCAAGTGAGAGAAAGAGCATCCATGGAAATATGTATTTC
GCTAAATTATATAGGTATTGCGCTCTTAGCCAGTAAACCTGAACAATGTATGGGCATTTCCAGGTTTCTGCCAGGTATGCAATTCCAGGATTATAAGGTG
GTCTTCTTTTTAACTCACAGAAATAGTTTCGTTGTTCCTGCAGCTCTGTGGTGAATATCACGATAATTATACACTTTCGATCGGTTAGAACAATTTTTAG
CTGACGAGAAAAGATCGCTTAGGAGGAGGCGATACGTCTTAGTGATTGAATTGTTCTTCTGCCCCATTTTTCATCTCACAAGAGTCTAAACCAACTGGTG
TACCATGGATTTGTGGTCTTGGGACTGTGACGGGCCATAAGCCTCGACAGCTACTTCCAGTTGGCGCTGCTGGCATGATGGCTTAGGAACACAGCGTCAA
GCCTCTTCCAGATAACAGTCTCCATCCGGCTTTCCCTGCTGGTTGGCTGAGGAGCAGCCGCAAGCAGACGAGACAAAAGTGATTACTGAGACTACTTCAA
TATAGTTACTAAGGTTGTCGTTGGGCGGTTGGTCACTTCCACTTTTGGAGTCCGATAACAACCACCGCCCAACTATCCCTTACGAAAGCCATTCTTTTTA
AGATAATTCTCTAAAAATGTAACTTCAGGTCCAGCCACTTCTACACCTTTGTATATCCAAAGTGGTGCGAGTCCATAGCAACTCGTTTTTTTACAAATTT
GAAAATTGAAAACTGAAACTGAAAAGTGAGATTATTAATCGGGTTGAATTCCCAGAGCAAAGCGGTAACAAGCCAGAGCAAAGCGGCAATACCTCGCCGG
CGACCTCAACGAGTCGGGTTTAAGTGCCGTACTGCATGTCTTCCATGCGCTCAGCTGCTGCAACAATGCAACGCCATCTTGTTCACCAAACGGAGGTCCA
TGCAGCTAATGCATTGTCTGGCAGCGCGTTTCAAAATCCGCATGCGGCCCTCGGCTATCTGGCCTCGAGGCCGACTTGCCACCAGTTCCTCTCGCGACAA
CGCCAGGTTCGCCTGGATTTGAGCCTTCAGGACGCTGAAGCAACCCTCAATCGGGTTGCACGTCGGGGAGTATGGCGCTAAGCGGAGAAGAACGAGGTCA
TCGTGCTCGACGACCCGTTCTTCCGTTTGGCTGTGTGCTGGCGCGTTATCCAGCACAACCACGATCTTCTTGCCCTCGAAATGCTCCTGAAACGTTGGTG
AGGCCTTGGCGTTTTCGTAAATCTCGTCAACGAATGAGGCGGTGACATCCATGCGGATGCTGCCACGTTCTAGGCGGTGGTGAACCAACCCAACCTCCGT
CGAGACGGCGCACTGAATCTGGAGATTGGCGCCCTTGGAAGGAGGCAGCACAACCGTCGCTCGTTCGCCCTTTCGCGCGCGGCCTTGGCTGCGCTTGTAA
TAAACGTTAAAATTAGTCTCATCGTAGTAAACAACGAAATCGCCAGCATCCATATGCTTGCGAAGGTCCATAGCAAACTGCTTGCGCTTGGTCTTGTTTA
CCTCGTTGTTACACGTCTGAGGCTCCACACGGACCTATATCGCAAAAATATAAGCCATTAGAACATGAGGTGTTAACTGGAGTGCATGGCGACTTACAGC
ATCTTACCTGCTTCAGCGTGTACAGCATCCCCAGGAGTCTATCCGATATGGTCGATGTGCTGATGTTCACACCGAAGTCGAACAGAATCATGGCCTTCAT
GGCACGCAGCGTGTACGTGCAATCGTCGCTAAGGTACCCGTCGAGAGCTGCCACTATCTCTGGGGTGCACTTGATGCAAGCGCTGCGTGCGCCTCCACGA
GGCGATGGCTCTTCACGGCCACTGGCAACGATCCGACGGGCCGTCGTTGGAGAAATGCCGTTGTGCTTGGCAACAAACATCCAATCCTCACCAGCACGAT
GAGCCTCGGGAACACGACCGCGGGAGACAGCAGAGTGTGGACTCCTTGGCATGTTCGATGAGGGGGGAGCGAGCTCCGCTGAAAACCGGAAATTGAGGAG
TAAGATCTAGGACACGAGTGGCAGCGCAATGGACAAGCTTTCCCGCCCACGCACCTCCAAGAAGCGCCCTGAACCACACGACGTCGTATTTGGCTTTGGC
GCGCAACCGATTTGGTCTGCGCAAACACCGCTTTGCTATCAACAAGTTCGCAAAGTAACAAAATTCTGCCGAAATTGTTGTGTTACTTTACGCCACTTCA
CCATATTGCTCTGGACTCGCACCACTTTGGACAGGCAAAGGTGTAGTTCTGTTCCTCTGTTATTATGGTTCGTTCCAACGGCCCCATGACCCGGTCTCAG
TCCCTTTGTAAGGCCTAGACAACTTCACAGGGATACAACCGCATTGTTCAATGTACTCCTCTCCGCGACCAGGGTTTATGAAATTCTGATGAAGTTCGCG
CTACTCTACTACCAAGGTTGATGAAATCCGAAGCCTCCGCTCGTACATATCCAGATTCTGTCGACACAACAATACATAAAAGAGTACGTACTGACACGCT
GACGTAGAGCTAAAGCTTCAACGTTATTATAGATCCATAGTTACTGTAGGGATGCGACCCTGCCAAAACCAATTCTATAATCTTATTTTCATAATTAAAA
CATTTCATGTGTCTTGTAGCGGGGCTACACATTCGGTTCTTAGTGCAACATGCACTAAGGAATACATTCAGGTTGAACACTTCACAGGGTGGTCCACATT
CATAGAAAAAGCGTGTGACTGGTAGAAAGTAACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCT
CATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGT
ATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCA
GACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGT
AACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGT
CAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCG
TGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCT
CTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGAC
GAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCC
GCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAAC
ATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAA
ATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGT
GGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGC
TGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAA
ACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGT
CAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGATCTCTTCGTTGCTCTAGTGGACTGTGGTGC
GTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCG
TTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGA
TATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAG
AGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAA
CGCCAACGACTGCGAGAGTCGTTGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCG
GTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCCCCCAGAGCCGACGCTG
CAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCT
TGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGC
ACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGTAGACACAGGAGTTGGAGA
CGACCTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCA
GTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAG
AGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCC
CTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTG
CCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAG
TGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGC
GACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTC
TATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGA
ACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGC
TGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGT
ATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTA
CGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTATACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAG
AAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAG
ATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCA
ATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTT
GGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCT
TTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGA
CGCCAACGCAGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTG
TTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGC
TTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGACATC
GGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAG
GTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTCGTTT
TTGGTTTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGAC
AGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAG
AAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACAC
CATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGGGTTCGCCGGTGCATGTCTCGACTGGACACGCACCGTTCTACGT
GAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGG