Description :
From Genome Similarity Track
Location :
Scaffold_3:26729- 29978
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-0.31TRAF-interacting protein

Sequence
3249 bases(100 bases per row)
ACCACCACAACCGAGGTTCAGGGGTCCAATcTtCGAATTCTGGGGTGGATCGGTCGGCGGCTTCGAGCGAGCGGCatGAGTTCCCCCTCACTAGTTGGCT
TCGTAAGGGCTAGTGAACTTGGGTAGTGTTATTTGATTCCCATCAGACTGTATGAATAAATTATTGAGAGGATGCTGCAGCTCCGTGTAGcTtGGCCTGA
AGCCTCTGTAGCACATCAGCAAGACGAGATTGTTGCTCATAACAGAATTCATCCAACTGCTCAATCGGAAACTGGTGGTctGGAATAAGTCGAGCATGAA
CATCTTGGAGCGACTGGAACTTCGATGTCTCTTCGGCCAATACCTTGCTCGTGTTGTGTTCTGGTGTGACTTCGACTGAtcTTCGTCGTCCTGCaGGgCG
gTTAAGAGgCGCTGCCTCCTGTTGCATAATCGGAGgCAATGATGAAATCCGAGAAAGGATGCAGTACAGCAGTGTGGCAACATTTCTCAAGTTCGtGgCC
ACAGACTTCGGAGTATGCTCGCCTCCAGCCCcTAGAATGACATGAGGAATCAGGATTCGTACAAGCACGAAATTGATCCACACGATGtGAAAATGTGGCT
TTCTAGTTTGGGGATTGCAGCCGCCCATGTTGCGTGTCGCGCCGAGACTATCGAAGTCGAGAGCACTTGCTTCGAACGCATGGAGTTGATACTACAGTAT
CAAACCGTCGTCAGTGGTACTCAAGTGTACACCCGAAGGGAATCACCCACGTACTGATGGAGGGAAGTAGACTCCGTCGGCCGTGATGtGCTTCCATAgT
TCTTCGATACCGTGTGGCACGTCATTCTTGTCAAGAGCCTTGATAAGCACGTCTATGAGGCCTTTCACACGGACTTTCAGCTTCACTGCCTTACTCAGTA
AGGCAGAAGAGGCCTGGTTATCATTTACAGAATCCGAAATGGGGACCACGCCCTTTGTGTTGGACTTGgATCTACTgAaCCAACTTGATATCCCTCTTGA
TACCGGGAATATTGTTGGCTTTGTGCTGATATCAAGATCAAGCGCcAGATCTTGGACGACTGAGgcAAGcGGTGTCTTCACAGTTTTGCTTAGCCACATC
CGAGTAGCATCGAAATACACATTCAGCATCGACTCCAGATCCTATCGCACGAAGAATGTTTGGAGTTATGTTGGACGACTGATAGACACCATTTGCTTAC
TTTCATCGCTTTgTCTTTCAATCGCAGCTGgTTTTGTAGAGACAACTTTCTCAGCACGTTTGAAGCCATTACAGCGATGGCCGCGGAGCGAAAAaCTTGC
GAGGGTGGCATTGGGATTTCGGCGACCTCCCCATTTtCATTCAGAGGCATAACGACGCCATTTTCAGCATCTAGTGTGATTCTCCATTGAGGGCGACGAA
tACCCGTCGATACTtcAACAAGACTCTCgTCGATTTGTTcAGACATCTTGCGTCGTGAGTCCATTCGATaTTTTTGCttctGAGTGTTTTTCtccAACAT
GATTGTGACATCTTCTTGTTCGTTTGTGTCGCTCTCGTTGATCACACCAGGTAAAGGGAGAATGTCTAGTCTCTGATCTGGATCGATTTCAAGCAACTTC
TCCAGCAGCTGAGGTATCAAaGTGGCCTGTAAAATAAAcATTCCGGGCATGAATACTAACTACTGTAGCGCAAACGTACCTCCTCCTCACTGTCTGTCCA
TTCCACCTcTAGGTGGCTTTCACTAGGTATCCATCGACCCGAGTCAACTTTCTCGTGACCTTGACGAGCTGTCAcACTCTTCGACGTTTGGTGTAGCAGA
GTCGAAGTGCAGTCCGCTTCCCGATACTCCTCGTCTTTCTCAATTGGGGGACCACCGTCGTGTTCTTGAGCAGATGTGCGTTCCGGCGTTTGACTCTGCA
TCTCGCGATTTTTGATAAACGAGAAAAGGTCTTCGTTCTGCTGCACCAGCCTCAGCGTCGTTCGCTCGATCGACGATAGGATATCTGCGTTAAGAGGGAC
AACTGGGATTTCGTGACGGCTCTCGCGATGTAAGGAGTGATTTTGTCGCTTTGTCTGCAACTGTGAGACTAGATCCTGCAAcTGTTTTACTTGTTGGCTG
CATTCGTTGCACAAAGCATCATCAGTTCCAaCGTGATGCATCGCTACTGAAGGTAAGACTGCGGCCTACGTCACTGCCTGTCGCGGCGTCgGCTTTTCAT
GTCGCCATCGCTCATGTATCTCTGCATGGTAATTATCAAGGCTAATCCGTTGAAGATACGGCTCAATCGCTGCTGTGGGAAGTGGGAAGAGCATATACTG
GGGAGAAGCGATTGCGTTCATATCATGAACTTTGACGTCTCGAAAACTTCGCCATCATCAAGCgaCTATTTTGGtcAGCAATAACATAACAAACAAAATG
TCCTATGGAGTTCGAGGGGAGGACCATGTTTCAGTTCCCTTAACTTGGGCTTTCGTGAAGCTAGCTAGTAGCGACCACCTCGGTCTGTTCAGCGACGgCG
ACGTCAGGGCTAGTTGCTTCCGTATCCTTCGATTGTGTGGCAGCAGCTAGTGCAGCAGCGGCTCTTTCACGGGCTCTATAAGCGTCTTTCTCCAATAGTT
CAATCGTGTCAAGCAGCTCTAGAGCTTTtCCcATGATGTCAGTTGAAGCCTTAATGATCGACGATGCCGATGACAGGCTCAGCTGTGTCACAGAGgTACC
ATCCAATGCCGCCAATCCcTCCATCATCATCTTGACCGAGTTGATCTCAtCCTTGACAAcgCcGACCTTGGCTGATACgTGACTGTACTGGCATTTCATC
TCCCCACAGATTtGCGGAAGCACTTCATATGCGTCGCTGATGTCCAGAACGCCTGCGGTGTGAATACCGTTCGAAGCAATCAGTTCGTACTCCGGTACGA
ACATTTCCGCACGCAACGCAAAAGCGCACGGAGAATGCTTTCGGAGGTCGTAAAGCCGAGGTTCCGAGTCGGGTTGAGTGGACGGGACGAGTTCCACCGT
GACCGAGTATCTCTCCCCATACTCACCACACAAGTCGCCGTCATCAAACGTAGCGTATTTGAACTTTTTGTGGATAGGATCGATTTTCCATCCTCGAAAG
ATACTGCACAGTGGAAACTATGAGCGAaCAAATATGGAGCAAGcAGGAACGTGgTGAGCCcCGCCCTGtCGACcGCACACTTACCCCATGAGTTTCCGAG
TTGGGAGCTCAGCCGATACCCCTGCCTcTTCCGTTCCTTCAGACGATGA