Description :
From Genome Similarity Track
Location :
Scaffold_258:26728- 28351
Transcript NameFunction/comments
Phypl_g6074hypothetical protein

Sequence
1623 bases(100 bases per row)
cgccatggacCTCAcggcggaggacgacgacctgctgaGCTACTTCCTGTCGGCGGATGTGGCGGccgagcagctgccgcagacGCGCCCGGGCGCGCCG
AACGCCAGCgcagcggccacggccgAGACGTTCACGCTGGGCCAGAACGCGCCTCTGGCACCGGAGCGGACGTTCGGCGGCGACCTGACgccggccacgg
ccacggcgcccgtcgccagcgctgcggcCTCCCCCTCCTTCCATCCGCCGCAGGGAAGCTTCACAGAGAGCTCCATGATGCGGCCGATCgtcaacaacga
cgacgacgactcgtcCAACACGGGGGGCCtggactcggacgagaagcggcagcggcgcctGGCCAGGAATCGCGAGTCGGCGCGCCAgagtcgccgccgc
aagaagcagtacctggagctgctggaggagaaggtacgagcgctggctgcgctgtGCGGAGAGAGGACTTTTTAATTGCAATGGACTGACACATGGATGC
GGTGCAGGTTTCTCAACTGACGGAGAACATTGACTCGACGCGCGCGACGCACTTGGAGCGCGCGGATGAGTCGCTGAACCAAGTGCGGTCGGATATATTG
AAGAGCCTCGCGGAAGACATGAAGAACGTTGGCTCAGAGGTGTTGTCACCCGTGCTGCGATGTGTTGGATTTAAACGATGGTTCTGATGTATTGACGTGA
TGGTTTTATTTGGTATCTGTACAGTCAGTGCAGGAGAAGATTCGACAGGGTATCATGCTGATTCAGGAGCGTTTTGGACCAAACAGTGTGGTGAGTAGAT
GCTGTGTGTGGCAGGCTGGCTATAGTAGTTTACGCATACGGTGTGATAACGCTTGTTTGTTGTACCACTTTATCGTAGGAGCGACTGGCGGTGAAGGACT
ATAACTTCCGTCAACTCGAcaatctgctgctgcctccgtATTGCCGGTTCCTGCTGTGGCTGAGTATTCAGGACGAGTCGTTCTTCGACGAACCCAACGG
AATGGGATCAAAGAACGCTGGAGACGTtccggagaagaagaagaccccCGTTATGATTAAGAAGGACACTCTGTGGTCGACTTTGACGAGTGACCTCGCC
CTTACTTACGAACAGGATGAGAAGCTGAAGTCGCTGTACAAGTACGTTTCTAATCGTGCGAAGTTACCGACTCTAATTGAGTATTGGTACTGATGCATGC
ACGTTGCGTTGTTTTTCCAGGTCAGGTGActccaagagcagcaagtcggAACGCCGACGAGTGGCAATGGCAGTGGTACGTCGTGAATTGAAGGTGGTTA
TTTCCTCGTCCCCAGGGAATTTACTTTGTTGTCCTGTGTTATTTTGTCGATAGACATATTTAAGCAAACTCAAGAAGagcctcgagcagcgctcgGAGGC
GGTCCAGCGACAGACAGAGATGCTGCACTCCATTCTAACGCCGGAGCAGTCGCTCACGTATCTGCGGTGGGTGGACGCCAACCAGGACCGATTGCCAAAC
TTCGTGGACAAGACGTTGTCGGTGCCGAATACAGGCGCTTCCGATGCGGTGCGCGCCATCCTGACGAAGGACGACCGCGATCTcacggtggaggacgtga
CTGCGTTGCTCGGAGAGCTGTAA