Description :
From Genome Similarity Track
Location :
Scaffold_6:2672066- 2675732
Transcript NameFunction/comments
Physo_512490gag-pol polyprotein
Physo_514794retrotransposon nucleocapsid protein

Sequence
3666 bases(100 bases per row)
CCAGTATGGAAGGCGCTGCAACTCAAGTCCAGATGAAGCTGATCCTGAGCTACACGGCAAACAACGAATCTCCCAGGGAAATATTCAACATACTCGCCCT
GGATGAGGTCGGAGATTCCATTCTGGCCAACCCGCTTTTCTCTCAATGGATGACGTATGTCGAGGCCTACAACAAGAAGAATCCACAGCATCAAGAGTCA
TGGTTCCTACCGCTTCAAATTAAGTATGAATGGCATGGCGTCGAACGGATGATCGATGCGGCGATGAAGAACCCAAGCACCGTGAAAATCGCCAAGCTGG
TGGAGAGGGAGTGGATAAAGACATGGTTAGACGAGAAGAAGCTTCCCGAGCAAGCGTTTAAGTTCCTTCGGCTCAACGACGCTGGTGAGAATGCGCTTTC
CGATCCCAAGTTCAGAGTATGGGCCAAGTACCTGAGAGACTTTAACCATCGCTATCCCGAGGATAAAACGACGATGCTCGACGGAATCCGGGCGATCTAC
AAGGATATCGCTGTTGTGCCGATGCTTAATGCGGCGAAGGAGCAATCCGCCACGAAGAAACTGGCGACGAACTTGGAGAATGCACTAATCAGCAAATGGG
TCGCTGAAGAGCAGAAGCCAGCGCACCTTAAGTACATATTCTCTGCTGATCCAAACGCCGATGACATGATCGCACGGAGTCGCTGGGGATTTTCTTGCAG
CAGTTAATATAGCTACGCATGATGTATCTGATTGGTAGAAAGGTAAGCCAATAGGAGGTCAGTGTAGGTACGACTCACCGTAGGTATAGTGAAACCAAGT
TAAAATAGATATGCAGATGTAAGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGAACTGCGGGGGCGGCACTCTTAGTTCCGCACGCCCTCCCC
CAAGACAGCACTTCTTCTTGTTAAACTGGTAGCACTTGTTGGTCCCAGCAACCTGACTACAAGAAGCCCATGCCGACGAACGCCCAGCTACGAGCCGAGA
TCGACCGGCTGAATCAAGCGATGGTAGAGCGCACGCGAGTGCCCACCAATCTGCCCAAGTTCACCGGCAAGCGGGGGGAAGACGTTCGCGAATGGCTGTT
CCAGATCGAGAACGCCTGTCGCATCAACGGAATCCGAATCGAAGACGCGAGCGCGCGTCTGCCGGGTATCGCCGGGTCGGCGATGGAAAAGCCTGCCTCA
GGATGGTTCTTGCACTGGTCATCGACGACGAGAAGTGAGGAGCACACGTGGGGGATTCTCCGTGAGCATGTGCTCCAAGACTTCGAAGCTTCGAACTACC
AGGCCGTCTTGCGAGAAAAGCTGCAGCGACTCAAGCAAACGGCGGCCATCGAGACCTACAACGGCGAGTACTCTGCTCTTATCTTCCGAGTTGAGGGCAT
GAGTGTACTTGACCAGGTGCTAAGCTACGCAAACGGTCTCAAGCCTCGTACCCGTAGCTACGTCAAGCTCGAGAACCCAGAGACGCTGAGCGCGGCTATG
GACCTGGCGATCAAGTACGAAGTTACGCACTTTGTGGACGACGTGCGCGACCGCCAGTCCCGCCAAGACAAGAGGAAGATCTTCGCTGATCAAGCTCCCA
AGCAAGACAAGCCATTCAAAGGGAAACCTTTCCGCGGCAAGGGACGGTTCAAGCCGAGGTCTGACTCCAAGCGTACTGAAGGCCGCACCTGCTATCACTG
CAAGAAGCCTGGCCACATCAAGGCCAACTGTTTCCTCTGGAAGAAGGAGCAAGAGAAGCAGGGAAACGAGCAACCACGTCAGTGAATGAGGGTCCTGGCG
TGGACGAGAGCGTAACCGGGACACCAAAGATTGAGAATATCAGCTTGAACGTTCTGTGCGAAAACCCTCTGGTCTACAAGTCACGTCCACTGTTCTCCGT
AACAGGTGAAATCAGTGTTGGTGACAAGTGTCTGGCGACACGAAGCAAGTTGTTGGACTGTGGAGCCACCACGATCTACGTATCCAAGCGTTGGGTCGAG
GAGCACCAGCTTCAGACAACCAAGTTCAGCGACAAGAACATTCGTGTCAAGCTGGGAGACAACCAAATTGTCGAGGCGGAGCTTGAAATTCTGCTGATAG
AGATTCTGGCCTCGAGGCTGGACGACGCCTACAAGTGTGTGGCAGTCGTCTACCCGATTCCAGACGAATTCGATTGCATTCTTGGAATACCATTCTTCGA
AGACATGCAACCACATATTGACTGGAGAGGTCGACGAATCGAAGGAACGAGAACGAGGACTCTGCACTGGAAGCGAACAGGGAAGACCTGTGAGCCGATC
GAGGAAGGCGGACCGGTGATTACCTCCGGGCTTCGGAGATCTGTCGAGGCGAAAGGCCTATCGGCGAAAAGACCCGCTGGAAACGGATGTGAAGCTCACG
GTTGAAGCTGTTGGTGACGCAGTGCAGAAGAAATCCCCAAGTGTTGTCCGCGGACGACATGATGACGCGCAAGCTGGCAAGAGTTCAGCTGGAGACGACG
ACGTTGCGACGTCTGAGCGCGAGAGTACTGTAGTCGAGGCTGATGGAAGCAGCAGTACCAGGGGTGGAGACAACGCCGTGGAGAAGATGTTCACGATGGG
AGTTGTCGACGAGAGTGGTATACAGACCAAATACATCACGCGCAAGAAGTTGCGGAAGTTCTTGAGAATCAAGACCAAGACGAGCGACGAGCCTGACTTC
ATGTTGGTGCTGTCGAACGAGACGATCAAGCAAGTTGCACGTTCACTGCAACGCCGAGATCAGCCCGACAACGTTGGGAGTGCGAAAGCACAACGCTATC
TGGAGACAGACTGGGACACCTTCCGAGAGAATCCAGCTTTCAATCTTCTCATGGAGTATAAGGACAACGTGTTTCGTCCAGAACTACCCGAAGGTTTACC
AGAGAAGCGTGACATCGAACACCGGATCGGTGTGAAGGATCCAAATATGGCGATGTACCGGCAGCAGTGGCGACAGTCGCCGGAGCAGCTGCGTGAAATC
GTGCGCTGGGTCGAAGACATGGTGAAGAAGAAGCTCATTCGACCAAGCATCAGCCCCACGCAGCCCCAACATTCTGTGTCCGGAAACCAGTTGGCTGGAG
AATTGTTCACGACTACCGGTACTTGAATTCGAACACCGTGCGTCAAAGGATCCCGATGACGAGGAAGGAAGACATCCTTGATGCCATGTCCGGTGCGTAC
TGGTTCTCCACGATGGACCTGATGTCCGCGTACTACCAAGTGCGCATGCGGGAAGAAGACATCAAGTTTACCGCATTCCAAGCGCCGGACGGTCTCTGGG
AGTATCTCGTTCTTCCAATGGGAGTTTGCAACGCACCAGCAACGATGCACAGATTGACATCGAAGCTCTTTCGAGACTTGAAGAACACGAAGTCGTTCTA
CGATGACATCTATGTTTTCACCAAGTCACCGAAGATCGAGGACCATCTGGACGCACTGCGGAAAACACTTGACATCTTGTGTGATAACAAGTTGTACGTC
AAGCTCTCCAAGTGTGTCTTCTGCTCCGACGAGATCCCGTGTCTCGGAGATTTCGTAGGGCGAAATGGAGTTCGGATGGATCCAGACAAGGTGCAGACCA
TCAAGGACTGGCCTGTACCACGGACGCAAGAAGAGCTTCACAGCTTCCTTGGCTTGACAGGTTACG