Description :
From Genome Similarity Track
Location :
Scaffold_6:2672066- 2673384
Transcript NameFunction/comments
Physo_512490gag-pol polyprotein

Sequence
1318 bases(100 bases per row)
CCAGTATGGAAGGCGCTGCAACTCAAGTCCAGATGAAGCTGATCCTGAGCTACACGGCAAACAACGAATCTCCCAGGGAAATATTCAACATACTCGCCCT
GGATGAGGTCGGAGATTCCATTCTGGCCAACCCGCTTTTCTCTCAATGGATGACGTATGTCGAGGCCTACAACAAGAAGAATCCACAGCATCAAGAGTCA
TGGTTCCTACCGCTTCAAATTAAGTATGAATGGCATGGCGTCGAACGGATGATCGATGCGGCGATGAAGAACCCAAGCACCGTGAAAATCGCCAAGCTGG
TGGAGAGGGAGTGGATAAAGACATGGTTAGACGAGAAGAAGCTTCCCGAGCAAGCGTTTAAGTTCCTTCGGCTCAACGACGCTGGTGAGAATGCGCTTTC
CGATCCCAAGTTCAGAGTATGGGCCAAGTACCTGAGAGACTTTAACCATCGCTATCCCGAGGATAAAACGACGATGCTCGACGGAATCCGGGCGATCTAC
AAGGATATCGCTGTTGTGCCGATGCTTAATGCGGCGAAGGAGCAATCCGCCACGAAGAAACTGGCGACGAACTTGGAGAATGCACTAATCAGCAAATGGG
TCGCTGAAGAGCAGAAGCCAGCGCACCTTAAGTACATATTCTCTGCTGATCCAAACGCCGATGACATGATCGCACGGAGTCGCTGGGGATTTTCTTGCAG
CAGTTAATATAGCTACGCATGATGTATCTGATTGGTAGAAAGGTAAGCCAATAGGAGGTCAGTGTAGGTACGACTCACCGTAGGTATAGTGAAACCAAGT
TAAAATAGATATGCAGATGTAAGGCGGCTGTGGAGGCTTCGCGAAGCTTCCATCCGCCTGAACTGCGGGGGCGGCACTCTTAGTTCCGCACGCCCTCCCC
CAAGACAGCACTTCTTCTTGTTAAACTGGTAGCACTTGTTGGTCCCAGCAACCTGACTACAAGAAGCCCATGCCGACGAACGCCCAGCTACGAGCCGAGA
TCGACCGGCTGAATCAAGCGATGGTAGAGCGCACGCGAGTGCCCACCAATCTGCCCAAGTTCACCGGCAAGCGGGGGGAAGACGTTCGCGAATGGCTGTT
CCAGATCGAGAACGCCTGTCGCATCAACGGAATCCGAATCGAAGACGCGAGCGCGCGTCTGCCGGGTATCGCCGGGTCGGCGATGGAAAAGCCTGCCTCA
GGATGGTTCTTGCACTGGTCATCGACGACGAGAAGTGAGGAGCACACGTGGGGGATTCTCCGTGAGCATGTGCTCCAAGACTTCGAAGCTTCGAACTACC
AGGCCGTCTTGCGAGAAA