Description :
From Genome Similarity Track
Location :
contig_182:2672- 5580
Transcript NameFunction/comments
g14616.t1hypothetical protein
g14617.t1hypothetical protein

Sequence
2908 bases(100 bases per row)
CGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACTAG
AGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGTT
CAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGC
GTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGCTTGCGAGCTCGCGTGC
AGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACG
GCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACG
CTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGA
TGAGGCTGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAG
CAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGA
AGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGACATTCC
TGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGCGTGAGCAA
GTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAAC
CACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATACCTCGAAAAGATGTGATCATCGATTC
GATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACT
CCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGCGCG
ACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCT
TGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGC
GTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGT
GCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTT
CGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATC
GGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATG
ACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCG
TACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTG
AATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCCGACGAAGTCCGACTACACCCTCGTCGTCCTTGCTGGATGACGTGAAGGCCGCA
TACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTAC
ACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGAT
CACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAT
GGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTG
CTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTAGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCA
TCTTGCTG