Description :
From Genome Similarity Track
Location :
Scaffold_220:26719- 28204
Sequence
1485 bases(100 bases per row)
GTAATCGAACAATAATCCCCCACACGACAAATTCGACAGCGGCTCCCAGGTTGGCTCATCATAGCCGACCCACTTGACCTTGAACTTCCGCTGAGTTCTG
GAGGTGCTCGTAGAGAGCGGCAACTCGTCGTCCAGGATGGCTTCGACTTCTTATTCATTCATTGCTTCGTCGGGCTCCCAGCTATCTTCAGGAAGGAGTT
CCTCGTCAACGTCGAGACGATCCGACTCGGCTAAGTCGGCTACTAGCCTAGTTGTCGGCCGCTCGCCGAGTCCCGTGACCGCTTTCAGACGTGACACATG
TATCACAGGGTAGAAACGGTATCCGCTCTTGTCCGGGAGTTCGAGCTCGTAGGCAAAATCCTCCACCTTCTTCTTCACTCGGAATGGCCCATGCCATCGA
TGTGGTAACTTCTTGGTCAAGCCAGGTCTGACTCGTTCCATGAACAACCAAACTTGGTCACCTTCCTTGAATAGTGACTTCCTCGACTCGGCTAACTCGT
CACCTTCCTCAGTCGACTCGACTGCTCTCTCGGGCGAGTTCGCTGGGGTATCCGTCCCTTCCTCCCCGGCTGGGACAGCTCCCTGCTCGACTCGGCTGAG
TCCGTCATTGTGTTTCTTCGCTCTCCGTTTCTTCTCCTTCAACTGGAACTCGGCCGCAAGCTTCAAAGCCACCTCTCTCTGTCGGTTTGCTTCCCTGCGT
CATTCGGCTGCCCCCGTTGAGTCACCTGAGTTGCCCCTGCCGAGCCTGACTGACTCGGTCATCGCCTTGAGTGTAGACCGAGCGTCCCATCCGTGTACCA
GGTAGAACGGGGTCTCCCGCCGAGTCGAGTCTCTCGAATTGTTGATGGCATGGACGAGCTTCTCGGCTACATCATCCCAGTCGGCTTGGAGAGGGTCTTC
CACGTACACACGCACAGTCTGGATCATGGTCTTCACTGAGCGTTCTTGCTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTCGCTCTCGACTTGGACTGC
ATCATCTCCGAGAACTTCTGGAACACTTCACTCATGAACCGGGGATCTCTGTCGTGGCGTACCAGTGATGGAGCTCCAAACCTCCGGAACACCTTCTCTT
CGAAGGCCTTCGCTTCCTCAAGTGCCCCAGTCTCACTCATTGCCTTAGCAATCACGAAACCGGTGAAGTGGTCTTGAAACAACAGCAGTGCAGTGTTGCC
CCGCCGAGTCTTCGGCAGTGGTATGACAAAGTCCATCGATACCACGTGGAACGGTCGCTCAGACACTACGTTGCCAGGTGAATAGCCCTTCAGGTGTGGT
TTGCTCTTACTGGTACTGCAGTCTTCGCACGCTTGGACATGTTTGACCACGTCTGCGTACAACCCAATCCAGTAGTAGTCGGCTCTGACCCTGTGGTATG
TCCGCACAATCCCTTGGTGGCCTCCCTCGATGGAGTTGTGGCAGTTCTGCAGGACCTCGTCTATCATGGTCGTCGGAACCACCAG