Description :
From Genome Similarity Track
Location :
contig_50:267154- 269714
Transcript NameFunction/comments
g8453.t1hypothetical protein

Sequence
2560 bases(100 bases per row)
GCGTTCACTGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTA
CTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGC
CGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGACGTGATCAGCATCTGG
AACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACAT
CAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCAC
CTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAAGTGGCTGAG
TACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGA
CCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTC
GCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCC
AAACGCACTTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTT
GCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCC
TGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCATGGAATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTC
TTAACGTCGAGACTGGAGTCGCGCGCCACCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCG
AAGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATC
AGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAACTGTGCAGGAAG
TGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAGCTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCG
TGTCCTGCCGGGTTTCCATGGCGAATTGTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTA
CGCAGATGCGGCTGCGGTGACTTATTCAAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCT
CCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTT
CTCAGGAAAGACCTCAGCTAGCAGCTCCCGCGCAGACGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCAACGAGACTGTGCTGCTTCTGCTGG
AATTGACGCAGTAAGCTGAGAAAGCCGTCCGGACCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTC
TTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACCGAGCACTTTCAGCCACGCGGAGCTCCTCGC
GCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAG
ATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCA
CCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCA
CAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT