Description :
From Genome Similarity Track
Location :
Scaffold_33:267127- 271936
Sequence
4809 bases(100 bases per row)
TTTTAGCTCTAACAAGAGCGAACGTCCGTCCAAATATCATCTTAATAACTTTGAGTCAAGAGCAGAACGATTTCTTTGCAACGCAACAGGATGTGTACAA
TATCCATGATAAAGGTCGTGAGAAAGTTCTTGACGGTAGGTATCCTTTGGCCACCTTTCTAGACGTATTGGTGGAGGATGATACCCAACATTTTGTCAGT
CAAACCGGAATGCTGAGGCGAAACTACCTAGCTTGTTTGTAGTGTCGCATGATGATTAGAAGATTTGTGCAACTTTGAAACGAGGAATGTTGTGGCTGTT
GGATGCCATGTACAATAAGAACCGATATAACTACCCACTACTACACATCATCAGAACCACATCGTCTAGCAAGACCTCCACACTTGCGTATTGTTTCATG
CGCCGCGAATGTACCGCTGATTACGCCTGGGCCCCCAAGTATTCGTAACTGACCGAGAGCTTACTCTCATGTCTTTCCCTTCCTGCGAGCCACTAACCTG
CTGTGTCGGTACCATATAAGCAAAAATATTTCCAAACAACAGCGGGGTACATTTCAAACGCACAATGAATATGATACAGAAAAGTCGATCTGGAATGCCT
TCGTTTTTCGAAGACTGAGACGGAGTATGAAAAAAAGCACAGAGAAATTTTAACTGGCACTTCGCCGCACTTTTTTCAGATACGTTTCTGCAACGGGGAT
TGTGCACAAAAAAGTTCGTGGAATTATCAATGCGAAATATTTGACACCATGGTCATTTGTCAACATCTCGAGTTAAAAGCGCTCACTCTGTACTCAAAAA
GTGATTTTATGTGTCGACGAATAATTTCATGAAGTTCCAGTCGCAATCCATCCGGCTTACTCCGAGCAGCTGACTACAGGTGAACGCAGGGAACAAGCAA
TTGTGGACATGTGGTTAGAATCCATGTTTTAGAATGTGATGGGGGAAGAGCAGTGTCTCGGCCTTAAAACTAACTTTTTAAAAGCCCGGACTGCGCAGCG
CATCAATTGGATAATGTACGGGTCATTATAAGTCAAGTATTGACCTTATACTTTTTTTTGAGCTCACAGTTGAGCCACCGCACGTGCTTGAGATATATGG
TTTTGATGGCCATATGTGGTTGTATGTGCCATGTGTTGTGGTGTCGGCGAGATTGTAAGCGCCGAAGCCGCTATGGCAAACTGTCGGGTGATTTACGATG
CGGAGCAACTTGCCCATCAGATCCAGATGCTTATAGATTGTCTATTGAGCTTGAATTATTAGGATATGGCAATGGTAAATAAACCAGCAAATTTCGAAGC
ACACCACCGGCCATCAGGATCGACGAACCAATTACTTTTTAGATTGACGCAGCAATGCATTTTAGAGTTTTAACGTGTGGAGCGGGCGTTTGAGCCAATT
CTCATTGCTTGGTGTTATAGTATGTGCCGTTGCGCTGGACACAACGCCCGAACCTGCTACTCCTTGCCGCAAGACGCTAGCTGAGTCACGCTAAGAATAC
AGCAATCACCAAGGATACGAAATGTTATGATGAATGAAAAAGACTAAGCATTATTGGTTTGAGCGTACGATAAAATCGAATAATAAACAAAAAACGACAA
ATAAATGTAAAACTGAATTCGTCGAATACATATGTGTTTGGGGGAGCAGCAAAAGAGTGATATCCAATTCGGTACAATTTTGGGTAATTGTATAATATTT
GGTTTAACTGCAGGCGACGGAACAAGAAGGTAGCGGCGATTGAGTGATTTTCTAAACAGAACATGTGACTCTCCTAAAAATACTAGTGGTATCCAAACAT
GCCATGGTATTCGGTCCACAAACGTATTTTGCCACAATAAAAAGAAAATGGGTAAGTAGATATCGAAAAAAATTGATAATTATCTAGAAAATTTCAAACC
AAAACCGAGTGAAGTAAGACAATGGAATGATAAAAAAAAGTCGCAATCCGCAACGCATGCATGGAAGGTATCCCGAACTATTGATTTTGTACGAGAAATG
AATAGGAACAATCCCACCGTGCCCACTTCATCATAACCGTGTATACTCTATTTTATTTCAGGCTGAAAGAATACAGCTGTGATACGTCGTGCTCGTAGAG
TTTAAAGGTAGTGATACAGCTCATTTCTTCATTAAATTTGCATTAAAATTTACATTGACGGCAGTCCGGCCCCTGTTTATCCTTCTTTTTGTGAATGGTG
TCATAAATATCTACACTCGTAATTGGATGTGATTTAATGGGATTTATAAACAATCATTTAACTTGTACCGACATCGTGAAGTTTAAGATGCGATGCACGA
CAGCTACGTCCTATGGTCCGCTCAAGAAAGTTATTGATCCCATCTCATGGTTAGTGCTGCGGCATAGTAAGTAGGAAAAACTTCACGCACAGTTTATATG
GTCCACATCTCGTTATTTAAAGGAGGACAAGTACGTAAGGACAGCCCGCTGTCTTATTGAGCATTGTCTGCGAGATGATCTTTCTTGAGACGGCCAGATG
CGCTATTATTCTCTTCGCACAGAGCATACTCCCATTCCTTATAAAAGGAGGCTACCTCACTAGCCGAACTTTCTAAGGTAACCACAAAACAATTCACACA
TGCATAGGTGTGGGCAGCTTCTTTCGCGACCTCAATAATATAGTAAATTTCTGCTGGAAAGATAGTATCGGGAGACCAACTTGAGTCACTCATTGCAGCC
TTCATATAAGAATAAGGTTTCAGAGCAGGAGCGGTGGGGGCAAGAGCGCAAACAAATTACAGTTTGACTGCTGCAGTATATATGTTATAATAGAGAAGAG
TTGTAGCAAGATACCATGTTTAAGGACTATCCCTTTGTTTTAGGACGAGTCACTAGTTTTTAGATTCCTCGTAGATGTTGTATATAAATCTGACCAGTTA
AAAAATATTTTTTCGAGTGCTTACTTGCGTTAAAAAGAAGTGGATCCAATAAAAGGTAGCATATCCGTTTTTCTGGATTTTTATCTATTACAATTGATTA
AAAGTGCTGGGTGAGTATTGAAAGTTGTAGTGTAATTCAGTTTCGTAATTGTAAAGAGCATCACGACTCAAGCGTCATAGGCGAAATCAAGCAATAGGTG
AGTAAGTTTATACGTGTATGAGATAGAGTTCAATTTTGTTGCTAGAAAAAGCCTTCGATTTTAACTAGCCATCACAGGGTCTGCGTTCTGGACGTATCTA
TCGTCAGGTGGGACTGAAACCTTAACATGGTGGTTCCTTTAGCATAGCAGTTCCACTGGTAAATTTGTGTTTCCGGCCAAGATGGCCATCGAATGAGTAT
TTAGAAAATAGACTGAGCCGGTGTGCGATTGTACGGCAGGATGGCACTTCGTAGTCATTCCATTTTATGCCTGTGCATCGTCGGGAGACATTAAATACAC
TAACATTTTTGCCTTTTGCCTGAATACACGGACATTTTCAGCTTTTTTTTGCTTTGCCCATCCCAAACTGTGCCGGCTATCCATTAGGCCTAATTATTGT
GTTGCCAACAGGGATTAAGCGACGCGCCATGGGTTTCGGCCGTTCCTTCTTCAATAACCCCCATCATTCTCACTATGATGTTGAGCCCTTTCACCTTTCT
CCTCTGGCATGGCAGCTTCTACTATTGTTAAAAATGCTATTCCAGCTCTTCGGCCGTGGAGCTGCGATGAAGTTCTACCAGCACAGCCCTTCGGTAGTCA
GAAGGAAGCCGTTCGCACCGCCAAAAAGTTCGCCATTAGCCAAGACTTCAATGCTATTCCAGCTCTTCGGCCGTGGAGCTGCGATGAAGTTCTACCAGCA
CAGCCCTTCGGTAGTCAGAAGGAAGCCTTTCGCACCGCCAAAAAGTTTGCCATTAGCCAAGGCTTCGCCGTTCGCATCCTATGCAACAATTTGCGTGGGA
CTATGCGCGTTTCTCTCTGATGCACCGAGAGAAATACGGGGCTTCTAGATACAGGCAATATCACGACCGACCCATGACCTTGCAAGTCTGTAACACTACA
AAGGTTGCGGTTGCTTCGGTCCCCGGGTCAGACTCGAAATGCACGCACCCGAAGAAAGTGTAAGTCGACGTTTTCATTGTACCCAGGCGGAAATGGCCAC
CATCCTAATGTTAAGATAGGAGAGCAAGCTGTGGAGCTCGCCCATTGATAAAAGTAATCTAGTTCGGAAAACTGAATCAAGTTGCAAAACACTATACTAT
AGCAGTCACTGAAGAATGTGTATGATGTTGTAAATGTCTGTATTAAACCAGTACATTATACTTGGGCAACGCGATCGGCCTTTAGTTATAAGCGTCCAGC
ATTTGCTTATGTGATCATATTCACCTTTGATCAATTTTAAGCCAATCATGTTCGTGCTCAAAAATAGTGACCTTGCCAAAGAGTGACTTCGGATATACCT
ATACCTATGAGAGGGATAGGCTAGATCGCACTTAGAACGTGCAAGGTACACCTAACCGCGTTATTTACAGACACACAGATGAGTACGATTTAAAAGTTCG
GCATTCAACCTTGCACACAGTCATTAATAGCTTCACCCTTCGGGCCCGCAATAAAATATCACGATACCGGTGGATCAGTGCACAACGCGATACGAGCGAT
ATCAATACAAAGGTCGTACAGGTGCGTTTGGCTGAAGCTGCTTTACGGGGACGAACGAATGTGCAAGCTTGACGCTTTCGAGTTATATAGAGCAAGTAAG
ATAACTTTTTGCTTGTTTGCATGGAAGTCTTGCCAAGAGCGGGGCTAGGATATGCGATTTGCTTCCAACCTTTTGGATAATGCTGTCCACTTTCTTTTGG
GGTTTGTAC