Description :
From Genome Similarity Track
Location :
Scaffold_55:267037- 269785
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15510hypothetical protein
Phypa_INRA-310PPTG_15511hypothetical protein

Sequence
2748 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCGGACTCTTCGGACGATGAGAAGCCCAAGTCCAACAAGCGCAAGGCTGAAGCTCCTGCTGCCGAGAAGAACAGCAAGAAGGCGAAGCGT
GACGCCGAGTCCAGCTCGGATGACAGCTCGTCGGACTCTTCGGATTCCGATTCGGATTCGGACTCCGATTCGGATTCGTCGGAGGATGAGGAAGCTCAGA
AGAAGGAGGCTGCGCGTCGTGAGCAGGCCGCTAAGGCCGCTCTGGAGTGGCAACCCAAGAAGATCGAGAAGGTGGCCACAAATGCCAAGGCGGCAGGCAC
CCCGTTCCAGCGTGTGGACGGTGAGTACTGGTCGCAGAAGATCGTGGACGACACGCTGCGTGACAACAGCTACGAAGGCACTTTCGGCGCTGACGGAGTA
GGCGTCAAGGCCAACAACAAGCTGCTCAAGACCCGTGGTAAGGACTTCACCAAGGGCAAGAACAAACTCAAGCGTTCGACGTACATGTGCGGCGCCATCA
GCATGGCTTCCAACTCGTTCAAGTTCGAGGACTAGAATCAAAGGATTCCCTTATCATCCCTTACTTTGCGATAGTACAACCTATAGAATATAATTCTCGT
TACATTTTCCTTTACTTCAGTGGCTTTCGAGACTGGAAACTAGTGTCTGCAGCTCTTTTAGACCCCGAGTTGAAGGCTGCCAAGTGTCCAGGCAGGGGAA
CTCGTTTGTCAGCGTTGAAGCTGAACTCGAGCTCTTCAAGTTGAGCGCCATAGCGTTTGAGTCTGAAACACGAAGGCCGGGAACGTAACGTTCCGGTGCC
TTGGTCTTGTCACCAGTGCCAAACATCGCAGCTGATACCTGCTTCGTCCGCAGTTTGTACGCGAACACTTTAGCCTGTAGCAGCTTCTTCTCTTGTATCA
AGAGTGAATCTGCTGACTGCTTTGTTTCTCCGGCCTTCGAAAGCTCAATAGCACGCGCGATATCCTTGTGTGCAAGGTCGAATTCGTCCTTCAATCTGTA
AGCCTGGGCTCGACGATAGAGTGCCTTGACGTTATTCGAGTCAATTTCGAGTGCCTGGTTGGCGTGATGCACTGCATCATCCAGATGCATTGTCTTGAGT
CGGCAAGCAGCGAAATTGAGCAGAAGTTTGAGTTTTAATGCGTCGGCCTGGACTTCCTCTTCATCGGTATCTGGAAACACATACTCGAAATATACGAGTG
CTTTGTGGTAGTGGAACGCCGCTCGCTGGTATTGACCGTGCTTGAAGAAGAGGTTGCCCAATACTCTGAACTCGTCACAAGCTGTTAGCTTCTCCTGGGT
TGTCATGTCCATCAGCTTTTGCTCCTAAACATTTCGGATGTAAATACC