Description :
From Genome Similarity Track
Location :
Scaffold_66:267027- 269776
Transcript NameFunction/comments
Phyra_71985succinate semialdehyde dehydrogenase putative

Sequence
2749 bases(100 bases per row)
CCCCAAAGCGTGCATAAACCGCTGGGTGACTCTACTGATACCATGAATTCGCGTCGTTCCACCGGCAGTATTGGGACTACTCGATCACTCCAGTGGCAGT
ATCGATATGGTTACGAATACGACGCTGACGGTAAGCTTGTCAAGAGCTCCAGGTCACAACCGCGGCCTATATGGACCGAACACACTGACCCTGACTGCGG
CATGGCCTATTACTACAACGTGCTCACCAATGAGTATCGATGGGAGAAACCTGCAGACTTCGACATCAACTATGAAGCTTTTGCTAGCGGACGTAGTGCA
AGCAGCTCCGCTCGTAAGTGGTTCGAGATGGCCCATCAAAAGCAAAATGCCGACGGCAGCAGCTCTCTCAGTTCTCGATCGTCGAAGACGCGCGCTTTCG
GAAAGAAGTGGGTGGAGCTGGTCGATCCAGAGACGCAAAACACGTACTACTACAACGAGGTGACAGGAGAGACGCGGTGGTCCCTCTCTCCTCGCAGTGC
ATTGGACACTTCAGATACGGAAGATCAGATCTCCTTGGCCCTGCTCGCGCAGGTGAAGCAACTTCGCGAGACGCCAGTGCCGTATTCATCTCGGGACCAG
CATATGAGCTGGCTGGAAGCAGCTATCGCCGAGAAGGGCTGGAAAAAAGCAGACGCGATCGTCCAGCAAATCTTCATTCGTGAACAGAGCCAAGCTGTAA
CTGACCGTCGAGCTAGAATCGCAGCCGAGGAAGCGGCGAGAGCACCTGTCACCTCAGATACAGCGAGCAATTTCTTGACAAGCAGCAATGTTTCCTCTGT
TTCGACTCCGAGCGCTTGGATCGAATGCACTGACGAAAGCAGTGGCGCTACGTACTTTTACAACCAGGTGACCGGAGAGACAACGTGGACCAAACCATCA
ACAGCACCTGCAGGTCAGTGGGAAGTGGTGCAGGATAACGATGACAAGGCGTATTACTACAACCCTGTCACAGGCGAGACGGTATGGTCAGAGCCCACCC
GGTGAGTTCGAAGGAACATATAACTTTATTCCACAGTACACGTCTGGGTCAAAACAATCTGGCAATGGAAACTTATGCCTCCAGGCCGCCCATGCAGACC
ATCTTCGTCTCCTGATACTCGTCCAAGCCCATGAACGAACCTTCACGACCGAGGCCAGACTGCTTCACGCCGCCAAACGGAGCCTGCACGTTCGAAATCA
CGCCCGTGTTCACACCGATCATACCGCAGTCTAGCGCAGCAGCAACGCGCCAAGTGCGAGACAGGTCCTGCGAGAAGAAGTACCCGGCCAAGCCGGCCTC
CGTGCCGTTGGCCATCTCGATCACGTCCTCTTCAGTAGAAAACTTGAACAGCGGTACAACGGGTCCGAAGATCTCCTCGCTCCAGACGCGCATGGTGTCG
TCAACGTGGGCGAGCACCGTAGCCTCGTAGAAGTTGCGGCCGATGTCACTGCGCTTGCCGCCAACGAGAGCCGTCGCGCCGTTCGTGACAGCATCCTCCA
CGAGCTCCGAGGTCTTGAGGAAGGCGTTGGGGCCAATCAGCGGGCCGAGGTTCACGCCTTCTTCGCGCGGCGGGCCCATTTTGAGCTTCTTGACGCGCTC
CACCAGCTTGGCCGCGAACTCGTCGTAGATGCTCGCATGGATGAAGATGCGGTTGCTGCACACGCACGTCTGGCCGGTGTTGCGGAACTTGGAGGCCATA
AGGCCGTCCAGGGCCTTGTCAACGTCGGCATCTTCGAACACAATGAACGGCGCGTTGCCGCCGAGCTCCAGCGACACGCGTTTTACCGTCTCGGCAGATT
GCTCCATCAGCAGCTTGCCGACGCGAGTAGAGCCGGTAAACGAGATCTTGCGGACGTCGTGGCTGCTGGTGAGCGCTCCACCGACCTCGGCCGCCTTGTC
ATTGGGCGACGGCACCACGTTGATGACTCCGGCGGGAATGCCGACGTCCTCCGCCAGCTTGGCCAGCGCCAGCGCCGACAGTGGCGTCTCCGCAGCAGGC
TTGACCACTGCCGTGCACCCTGCAGCCAAACAGGGCCCCAGCTTGCGGGTGATCATGGCCAGCGGGAAGTTCCAGGGCGTGACGATCCCACAGACACCCA
CGGGCTCCTTGATAGCCAGGATCTTGTGGTCGGGCGCCGATGTGGACGGCAGGAAGCCGCCCGAGTGCATGATCTCATGCGCGTAGAAGTCAATGAAGCC
AGCAGCGTAGGCCACCTCGCCCTTGGCCTCGGGCTGTGGCTTGCCGCTTTCCACGGAGGCGATGACGGCCAGGTCCTCCGTGTTGGCCACGATGGCGGCG
TGCCACTTTTTGAGCAGCACGGAGCGCGCGGCGGGCGTGGTCTTGCGCCACTTTTTCTGGGCCGCCAGCGCCGCCGCGATGGCCTCATGGGTCTCGACGC
GACCCATGTTGGCCACGCGCGCGATCTCCTTATCGGTGGATGGGTCCATCACGGCGAAGTGCTTGTTGGAGTGCGCCTCGACCCACTTGCCGTTGATGAA
GCCCGCCGACTGGATCAGCTCCTTGTTGTGCACCTCGGCGTGGAAGAAGCGGCGCGTGGCCAACGAAGCCGATGGCAGCACGGAGCGGTGGATCTTGGAC
GACAGCATGGCGGAATGAAGGGCGAGCGGGCGCGGTTTGGGCTCGACGGTGCAAGTTCGGAAGTGAGCCGTTGCGGAAGCAGTGCTTCGACCGCCAGGAC
CACTACTTGGCGTTTGTATGGGGTACGTCAGCAACGCGTACGCTCCCAA