Description :
From Genome Similarity Track
Location :
Scaffold_840:2670- 4125
Transcript NameFunction/comments
Phypl_g11245hypothetical protein

Sequence
1455 bases(100 bases per row)
TTTCGTGAAGCCTTTGGCGTTCTCGGAATGCCGATGCTGTCCATCCTCCTTGTGTGTCTTGCATGGACGGCGTGGCTTATTTTCCTCGCTCTGGCTCCAA
ATGAAGCTGCGAACAGACTCATGAACACGGGCGCCTATGATAACGGAAGCTTTTGGTATATTACTGACGCAAATCCTAGGATGACAATGGTTGGAGCTGT
GGGTTTGATGGTCATGGCTGTCTGCTATCTCTTCGTGATACTGAGGATGTTATTGTGGCGAAACTCGATATTATCATCGAGCACGCACAGTAAAGCGGGG
CTTTGGGCTTCTTCTAGGATGTTACGAGTTGTTGGTCCGAGCTACACACGTGGGCGTCAGCTGTGgacggagctggcgtcgTACGAGGGTAGAAATCGAA
AACGTTGGGTACGACCTTGTGTGAATCAAAGTATAGTACGAGGTTTGCGGACTAAACACTCACTTGATTTTTGTAGAACGCGTGCCTCAAATTGATTGAC
TTGGCTATGGAGACAGCcatgcttcagcagctgctgcaaagtGGAAGCCCCGTGAGTCTTACATACGGTTTTGCAGGGTTTCTTGCCGTGAATGCGCTGT
CTACCGTTGCCAACGTGCTCACCGATGGATTTTCAGCTTTGACGGAGATATTCATCGACTCAATGTACGTGCTGCGACAGGTTCGTTTAGCGTTAAGCTT
GCAATAATGTTGACCGTATCGTGGTGTGTGTGCTTGGTGTTCGTTCAGCTTTGacctggcagcagcactttgGTTCCCGATCTTGACGTTAGTCTACTGC
TACTACAACTTCGACTTCGATCGCGAAGCGTACCTCACTTACTTAGAGAAACAGCCAGTCGGGAGCTTTGAACACAACGCTCGGTCGTTTGCCGATCCAT
ccgagctcgcgctgttTCGAGTAAACTTCGACTCGCTTCGCATCAACTCGAAGCAAGCTTTTGCACTACGAATTAGCATGAACTTAGCCTTGTGTTTCCG
CTTTGAGCGTATCCTGGAAGCTCTCATCTGGACAAGATACCGCGAACACGCATCACGAGGAGTCAAGAGAATTGTATCAAATAGCGCCGCCGAGGTCCCG
CAGAATCCCGTGCCGAAAGGTGTCGTGGCGGTCTTTGTGGCAGCCATTCTGGTCATTTTGTTGGCAACGCACAAGGCGATCGTGGACTCCGCTTCGTTAT
GCTCGTCACATGCCGAGTGTGTCGTGTACGCTCATCGGTGAGAGCTCAGTGACAAGCATTGTCCTTGTCTTACCCTGATTGACGTTGACCTTGCGCCAAA
GACGTACAACCAGCGGGTGGATCCGGTTGACGCGTACGATAAGGTGAAGACTCTGGCAGGGGCGGGGATGCTCACATTGCTTCAAGTGGTTAATCGCCAA
CTGGTCGAGTGGCCGGAGGAGCTTCGCAAGTGCCACAACCTCAAGACGATGTACG