Description :
From Genome Similarity Track
Location :
Scaffold_2011:267- 3330
Sequence
3063 bases(100 bases per row)
CGGTGGACAACGAGATACTCGCGCTCCTGCGCGTGTTGGACCTGAATTACAACGTGCTAGTGGGAAGATTCATCCGGATCCTGACTCGATACTCTACGCT
AGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACGCTCGCAGCTGTGGCGTTGGCATGTTGATGGTGAGCCGATT
CCAGACCTCACGCGATCAGAAAAATGATATCCCGTAAAGTGCTTAACAGCAATAAACGTAATACGCTCGGGTTGTAGTGCTCCATGACGCGGCTCCATTG
AAAGGGTACCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGA
TGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTTCAGGCAGATGAGGATCTGTACGTCCTGAGT
TTCGATGGATCCGCTCGCGTACGACGCGGAGGCGGGGCGTACAGTGCAATACTGTGTAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCACTTATG
CGGAAGGCCTCGCCGTCAACGAAGCGGAGTATAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGA
TTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGACCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGG
ATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATATCTTGGCCAGTGCCGCTTTACGGAATCAATGCGGTGTTGAGGTCGAGA
GAGAGGCCGAGCATCAGTATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCAGTCACTAG
GTCCAGAGGAAGGATTTGATTCAGTCCCCAGATCATCGAGGAAACATTTGTGAAGAGAGTCCGCATTGGGCGGATCCTCAAAGCACAGGACGAGGAAGCG
TGGATCCTAGGACTAAAGAAGTATCTGATAAGGGATGTACGAGACCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGG
ATCGGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGATCGAGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGA
TGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAAAGGATCCGGGAATGTTTTCACTGGAGGGGACTATTC
AAGAGCGTACAACGGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCAAAAAATATCCAAGCGACTT
ACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGACA
CGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCGTACGAGGAGTGTGTTTTCCGATGGTTTGGAGCTAGCGAAATGATTAGA
CATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGTATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTA
ACGGATCGGCCGAGCGCATGGTGCAGACAATCACGAGAGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACT
CCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGGGGTGATATCCATTTTACTTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCC
CAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATTCCAGGTGAACGAATGACT
GCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGATGCCCGTCCACATCAAATCCAAATGGGATCGCAGGTGTGGCTTTATTTGGAAACCGAG
TGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGGCCGTTCCGGGTGAGCGAGAAGATAGGGGAACATGCTGTAAAGTTGGAAACGGCAGG
TACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAGAAATACCCGGATCGGTCGCAAACCCGTCTTTCAGTGGATGAATCC
GACCGGGTGGATTTTGACGAAGTCCTCCTACCGGAAGATAGTTGGAAGGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCGCCGATATGAGGT
CGGGGAAGCGAACTAGATACGGACGGATTAACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGAACCCAGTTGCGTAGACGAGGCAGATCTGAACTG
TGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGATCCATGGATG
TGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTGGGCCAGGAGGAAGGAGGATCGCTGATGTGAGTTGGTTACATCGGAAAG
AAAGAGAAGACGAATCCACAAGAGAGGTGTGGATCAGGAGGAAGGAGTGAATGTTTATGCGTAAAGAGTGACGTTTTACGTGCGAAGAGTCCCGTTTGAT
TTCAAGCACGAGCTTTCAAGGGCCCGAGATATACTGACCCAATTGAAACTGGGTCGTTCGCGCTAGATCCGGATGAAATCCAGGCGTGGATCCAACCGGA
TCCGGAATCCAGCCCAAATCCAGGTGTACACTGAAAGGGTGGATCCAGCCCAGATCCAGGTGT