Description :
From Genome Similarity Track
Location :
contig_5:267- 1882
Sequence
1615 bases(100 bases per row)
TCGTCTTCCCTTCGCGAAAACGTTGTCGTAGCAGACAGTTCCACGAAGAATAGTGACATCGTCGTTTGATGCTGAGCCAAGCCGGTATACTAAGCGAGAG
AACCACAACATCAATGTGAACGATCGACTGACGTAAAAAGGTATCACACGAAAGCTTAGTTGCTGACCCCAAATAGTGCCCTCAAAGATGACCGAGTCTT
GGAGTCGTAAATCTCCTGCGAAGAAGATCCGGCATATGATTGCGATGTGGTCAGCGAGCAATAAGCATAATATGGTTGCGGCAAACCAACTACGAAATCG
AAGCATTTCCCGCATGACTGGAGTTAACGCGTCTAAGGTGAATACCCAGTGTGCCCAAAGCCACCACGAAATCACCATCAAGCTGTGCGCGACGTCCCAG
CTGTACAAGACGCTCACAGAGATACTTGCAGACGTGACTTGAAAGGAGTAAAACACGAAGTCAAACGAAGTAAAGAGCAACTGAGTAGTTGGGGCTGGTA
AAATCCAGCAAATAGAGATGTGAACACGCCTGTGCACAGCAGTGCGCTTGATGATACCATCAATATAAAATCTTCGTGTGCTGTAGGATCATCATGTGAT
TCATTAAACTCGTGTGCAAGGGCGACGTGAGAAAGTATCAGTCCAGCTGCTCCAACTGAATACAACACAACCATTGACCACAGCGGAAAGCGACGTTTGT
TTGCCGTTAGCCAAGGAAGCAGCGTGTTACTCGCGGCGAAGGTCTGAGAAAAGTTGACAAACATTAAATGTTGCACGATATCAGTGTCTCTCAAGGATGA
CATCTTTGCTTTGAACATGGAATCATTCGTTTCCCACGCGGACGATTCTGCTGGTGCTTGCACTGGTTGCAGCTTTAGTATGGCGCGATAAATGACACAT
TCAACGATAGCTGGTCTTTTGGGATGAGAACGCAAAACTTTGCGTCTCCGAAGCACAATTTTTGCAAGCAGAAATCCAAGTGATACCAGTCCGTTTCCGA
TCACATCCAGCCCCGAGAGCTCAAAATTGCCATGTCTGGTTTGATATTTGAGAATTGAAAAGATTGAGCCACTATCCACGTGCCCAAGCATTATCCAAGC
AAGTGCAACGAACACCGAAAAAATCGCCGCGATCAGAAAGCAAGTGAGACTGCGGAGGCCCAGAACATGAGCATCAACACAAATGACGTGATGATATCCT
ATCCAGTCGATCACCGTCCGGACCGAGCGCAAATCTCCAAAGTACATCGACATCGTAACTACAATCACGCTTGTGACAACGGAGAAGAACCAGAAGTCGA
ACGTTCGACACACCAAGCGCACGATATCGTATCTCAGTGTCGTCACACTTCCCAACCCCATAGGGAGCCATAAGAGAACGGCCAATATCGACATCACGCA
GCCCACTGGAGCCTTGACCATGGGCACAATGGCGTTGATGCAGTAGGATACTGCTGCGCAAAACAAGATTTCTCGGTAGTACTGGTAGTATCGGCGACGG
ATGTATGTGTGAACGCTGCCAGGAATAAGCCGGCCTCGAAACGTCTTGGATAGGTCAACGACTGGAAGCGGCTGGGCTGGTACTAGTGAGTAGATGATGT
TGCAAGATGTAGTCG