Description :
From Genome Similarity Track
Location :
scaffold_5:267- 1881
Transcript NameFunction/comments
g8100.t1hypothetical protein

Sequence
1614 bases(100 bases per row)
TCGTCTTCCCTTCGCGAAAACGTTGTCGTAGCAGACAGTTCCACGAAGAATAGTGACATCGTCGTTTGATGCTGAGCCAAGCCGGTATACTAAGCGAGAG
AACCACAACATCAATGTGAACGATCGACTGACGTAAAAAGGTATCACACGAAAGCTTAGTTGCTGACCCCAAATAGTGCCCTCAAAGATGACCGAGTCTT
GGAGTCGTAAATCTCCTGCGAAGAAGATCCGGCATATGATTGCGATGTGGTCAGCGAGCAATAAGCATAATATGGTTGCGGCAAACCAACTACGAAATCG
AAGCATTTCCCGCATGACTGGAGTTAACGCGTCTAAGGTGAATACCCAGTGTGCCCAAAGCCACCACGAAATCACCATCAAGCTGTGCGCGACGTCCCAG
CTGTACAAGACGCTCACAGAGATACTTGCAGACGTGACTTGAAAGGAGTAAAACACGAAGTCAAACGAAGTAAAGAGCAACTGAGTAGTTGGGGCTGGTA
AAATCCAGCAAATAGAGATGTGAACACGCCTGTGCACAGCAGTGCGCTTGATGATACCATCAATATAAAATCTTCGTGTGCTGTAGGATCATCATGTGAT
TCATTAAACTCGTGTGCAAGGGCGACGTGAGAAAGTATCAGTCCAGCTGCTCCAACTGAATACAACACAACCATTGACCACAGCGAAAAGCGACGTTTGT
TTGCCGTTAGCCAAGGAAGCAGCGTGTTACTCGCGGCGAAGGTCTGAGAAAAGTTGACAAACATTAAATGTTGCACGATATCAGTGTCTCTCAAGGATGA
CATCTTTGCTTTGAACATGGAATCATTCGTTTCCCACGCGGAAGATTCTGCGGTGCTTGCACTGGTTGCAGCTTTAGTATGGCGCGATAAATGACACATT
CAACGATAGCTGGTCTTTTGGGATGAGAACGCAAAACTTTGCGTCTCCGAAGCACAATTTTTGCAAGCAGAAATCCAAGTGATACCAGTCCGTTTCCGAT
CACATCCAGCCCCGAGAGCTCAAAATTGCCATGTCTGGTTTGATATTTGAGAATTGAAAAGATTGAGCCACTATCCACGTGCCCAAGCATTATCCAAGCA
AGTGCAACGAACACCGAAAAAATCGCCGCGATCAGAAAGCAAGTGAGACTGCGGAGGCCCAGAACATGAGCATCAACACAAATGACGTGATGATATCCTA
TCCAGTCGATCACCGTCCGGACCGAGCGCAAATCTCCAAAGTACATCGACATCGTAACTACAATCACGCTTGTGACAACGGAGAAGAACCAGAAGTCGAA
CGTTCGACACACCAAGCGCACGATATCGTATCTCAGTGTCGTCACACTTCCCAACCCCATAGGGAGCCATAAGAGAACGGCCAATATCGACATCACGCAG
CCCACTGGAGCCTTGACCATGGGCACAATGGCGTTGATGCAGTAGGATACTGCTGCGCAAAACAAGATTTCTCGGTAGTACTGGTAGTATCGGCGACGGA
TGTATGTGTGAACGCTGCCAGGAATAAGCCGGCCTCGAAACGTCTTGGATAGGTCAACGACTGGAAGCGGCTGGGCTGGTACTAGTGAGTAGATGATGTT
GCAAGATGTAGTCG