Description :
From Genome Similarity Track
Location :
Scaffold_2874:267- 1840
Sequence
1573 bases(100 bases per row)
AGCTGGAGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTAGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACT
TCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCA
GTACCTTGGATCCCCCATCCTTGATCTTCAACTTGTGTAGTAGACCGGCCACATTTAGTCGATGCAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCG
AGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGAAAACGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCA
GCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGACCGCAAAGGTTAAGCACTTCTCAGCATCTGTCGCTTGATCTCTCATGAGGGCTGACTTTACT
TTACTGATCCATGTCCTCGCTCGGTCCTCGTCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGGTCATGGACG
ATTCACCCACCCCGGCTGCGGCTGTTGCTACCACCGCTAATGAAGGGGATGGGCCATCCCGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTCCCTC
CACTGACTCTATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCCCTTGCGCTTGTGGCACGGCGCTCTCGTACCCTGTTCGGCCAGGAAACGACTCATCG
CAGCTTCGAAGTGTCGTTGCAGGGTGCCCGAGGAAGTGTAGGAAGAGCCTGTGGCCGTCTGGTCCACCGGCGAGTCAGGATCCGTGGGGCGATTACCTTG
AGCCCGATCTGACGATAACCCCACTGGTTTCTTGCCGGATCTGGCTCGATCCTGGTTGGATTGTATCAGATCACAGGTGGGGCGTACTGGATCCCGAGTC
TTCACGCTCAAAGGCACTTCCTGTCCCCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGCTCGGACGACG
TGTCGGACCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTCCGCGACCTTTCTCCGGT
GATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATG
CCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCATGTATCTTCGATCTGTC
GTGGATTCAGGATCCACATGACAGGATCTTGATGCAGAATGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCT
GGATCCAGCTTGGACTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGGTTTCGTCTTC