Description :
From Genome Similarity Track
Location :
Scaffold_1492:267- 1519
Transcript NameFunction/comments
Phyag_g10776hypothetical protein PHYSODRAFT_285823
Phyag_g10777hypothetical protein PHYSODRAFT_503133

Sequence
1252 bases(100 bases per row)
TTAGGGGAGACAAAAGGGGGTGAAATCGAACCTGCCAAACCGAGCCCCATTATCTTTTGAGTATTCTAGGCCACAACATTGGTTCATCCTTTCAAGTCAA
CGGGCCTAACCGCTACATCCAGATCTTTCCAATGAGGCCCTGCACGCTTTTCAAGGCTTCGTTTTGGCGTAGATTGAGCTTTCGAACCCTGTGACAGGTG
CCCGTTTGAGCATTTGAGTGCCATGACATCCATCCTCGGGCTGTCAATTAATGTCCGTCTAAATTTGGTGGTAGTATCATCGACCTCATTTTCCTACGTT
TCCATACAAAGTCCTATATACGCGCTACGTTTCGACGACAATCTGCATCTTCAGAAAACGATGGACGTTGTGACTCCTGCTCAACTCGAGACCAAGATCC
GCCAGGAGATCGGCGCCgcgctggtggaggccgtggacCTGTCCGACGGATGCGGCAGCAAGTTCAgcctcgtggtggtgcacGAGGGCTTCGAAGGTAC
GGCCGCAACAATCAGCACCTCTGTAGCGAGCGATCCAAAACGACACAATGACCGAACTAACACCGTTATGCTGCAGGCcaatcgctgctggagcgccAAC
GCCGCGTGAACGACTGtctgaaggaggagatgacgcgcatccacgcgctgcagatgaagacgtggacgccCGGGCAGTACGagcagaagacgcagaagaa
gctgcccTCGGCCGCCAACAGCCAGTCCTCGGAGGAGCATTAACATCTACAGTAACACCCACCAGACCTGAATTGAGCTACCGTAGAGGCTCTTGATGCC
TTTGCAACCGGTGGATTTGTGAGTATTGATTCAGTTTAGTTTAAGAGAAATGTGGGGTGGGTGGCTACTGCGTCGAGACAGGGGAAGCGGGCAACGTAAC
GGACTGCGCCAAGTCGTCCAAGCTCAGAACCAAGTCGTCGGGACTTGTTTTCTGccacggagaagaagaagaagttgctgctgctgctgctgctgctgtg
ggtgtTGTCGTGGTTGGTGTTTGCTCCAATGCACTCGTCGCTCTATCGCCGGTCGGTTTGACGATGAGCCGCTGCGCTCTCGCAGTCAGCGGAGACAAGG
CGGCGTCGGAGCTGatactgctgctactgccagATCTTGTGAAGCTGTGCCAGACCGAGGGCTTGGAGGATGGCGAGTCGTTCGGCGCTGCAATAAGAGA
AAGTGATGCGCTGCGGTTGCTAGCGTTCTTCCGCGGACTAGGACTCTTGCTT