Description :
From Genome Similarity Track
Location :
Scaffold_1037:267- 1357
Transcript NameFunction/comments
Physo_145324hypothetical protein

Sequence
1090 bases(100 bases per row)
GTCGCGCGTACCGCGTTTCAGTGTGCTCACTTTCCAATTCACCTCTTCTCGGACAAGGCGTTAGAAGCAGCAACCCCACACCACACCCTGCAAGCACTCG
TCCACTTCACCATGGCTGCTCCCGGTTCCAAGTCGGCCCTCATCACGATGGACGATGCCAAGACGTCCTTCAACCTCTTCTGCTGCGTGCTCGGCATCGG
ATCGCTGGCCATGCCCTCCAACTACGCCCGCGCAGGACCCGTGTACGCCACCATCGCTCTCGCGTTCATGATGTTCGCCAACACATACGCCGCCATGAAG
CTGTCCATGGCTATGCTGGCTGCTCCCCCTTCCGTCAAGACGTATGGCGACCTGGGCGAGTGGGCTCTGGGCAAGTGGGGCCGCTTCTGCACCGTCATCT
CTCAGATGGGTGTGTGCGTGCTGGTGCCCATTGCCTTCCTGATCCTCGGTAGCAGTCTGCTTGACGTGCTGTTCCCGGACTGCTTCAGCCAGACGTTCTG
GACCATCTTCATGGCGCTCATGGTCGTCCCTGTGTGTCTGATCCCAACGCTGAAGGAGAGCGCTGGTATGGCGTTTGCTGGCTGCATGGGCACTGCTATC
GCCGACATCATCGCGGTGTCCATCCTGCAGTACAACATGCGCGGCCACCCGTCGATCCCCAAGCCCGATGTGTCGATGACCCAGGTTTTGACCTGCTTTG
GCAACTTGGCTCTTGCTTACGGAGCTTCCATTGTGATTCCGGATCTCCAGCGCGAACACTCACAGCCTCAGCGTATGCCGCGTGTGGTGGTGGTGACCAT
GCTCATCATCTCGGCCTTCTTCTTCGCCATCGCGCTGGCCGGATACACGGCCGGTGGCTGCCAGATCTCGGGTAACATCTTGTACTCTATCGTGGACACG
TCCAACCCGTTGGGCGTGGCTCCTCTGGGCTTCAGTGCCAACCGCGGCGCTGTCGTGATGGCCTATCTGTTCATGCAAGTCCATATCTCTATCGCCTTCT
CGACGATGATGATGCCGGCCTTCTACATGGCCGAGCGGTTGGTGCTGGGCATGCACAAGACAGCGCGTATCGTCCGCTCGACGCTGAGCA