Description :
From Genome Similarity Track
Location :
Scaffold_66:267- 1305
Sequence
1038 bases(100 bases per row)
TCGTGCGACTGTAACACCCCGAATCGACTTCAATTGATCTGGTCACGCAGGTAATCATGCAGTAGTGCTCCACAGTTAAGACCGGCTTCGTCGACCCATG
TCGGATTGTCGTAACCTTTCCAGTGGGCCAAGAACTCGCACAGCTTCCGTCCGTAGCGTGTTCGACGTCCTGTTCACTCGTCCGATATGCGTTCGACTTC
GTGTTCACCCTCGTCGAGCTCAGTGTCCGAGCTGTCCCTAGGTAACAACCTACATTGACGTCGAGTCGATCTTGATCTTTGGCTATCAATCTCACATTCG
GGCGACCTGGGAATCTCCGAACTAGTTTCAGTTTGGACACATGTACCACTGGAAACACGTAATAGTCAGATCCAGCGATTTCTAGTCTCACCGCGTGCGA
GTCGACAACTCCCGCAACTCCGAAGGGCCCATGGCGCATGTGTGCTCCTCCTATACGCGATCCAAATACAGCCATTCTTGTGAACCAACCTCGATCTTGT
GTGGTCGGGTCGCCTCGTTATACCGATCTGCTCTCTCTTGAATAGCTTCACGGAGACGTTCATTAACTTGTTCGCGAGCCTTCTGGTAGTGTTACTGGAT
ATGGTAACGCCCCCGGCGGGGTTCTTGATATCGACATCGTGTCGATCCTAGCGGAATCGCGGCCTCCAACGTAGATCGAGGATCCCATCCATGAACTAAG
TAGAACGGCGTGTCACCACGAACACGATCTTGAGCCTTATTGAGTGTGAAAGTCAACTGTTCCGCGTATTCATCCCAATCCTTCTGGTTTACATCACCCA
CGTACATCTTGAGAGCACGTGTTAATGTCTGTACCATGCGCCCTGGTGTGCCGTTGGCTTGAGGGCGATATGCCATAGTCGCTCGCTGCTATTGGCCGAC
GATCCTGTTGAATGACCTGAAGAAATAGGGCATGAAGCCAGGTTCTCGGTCATGTCTGATCGCCTCACTTGCACCAAATCGACGAAACACACATTCTTCG
TAGTTTTCTGCGATAGTCTGAGCAGTCCTGGAGGAGCT