Description :
From Genome Similarity Track
Location :
Scaffold_294:26699- 28371
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_294-fgenesh-gene-0.3Folate-Biopterin Transporter (FBT) family

Sequence
1672 bases(100 bases per row)
AAGCTCGACATCGCCCAGCGTGCCTCTTACGTCAGTAATGCCTCGCAAGCCAAAGAAGGCGACTACGTTGACATGAAGACCCCTGACGTcGAAGCTGGCG
CGCTCCGTGAAGGTGGCGCCCcAAGGCTCATCAGTAAGGACTACTTCGGTGTCATTGCCCAGTACGCCGCCGTCGGTCTCGTCGATGCCGTGCTGCCTGC
AACGATCTACCCGTTCCTTCAAAACTATCTCAATACCAACGGCGCGACTTACGTCACTGCCTCGACACTCGTGCAACTCCCGTGGTCGTTCAAGTTCTTC
TAcGGTGTGCTTTCGGACTGCCTTCCTATCTTCGGTTTCCGTCGTCGTCCGTAcATGGTGCTtGgTTGGACGATCTGTATCATCATGCTCTTGGTCATGG
GCTTCACGCCCATGGGCGACCCGTATTGGGCTACTCCAGAAGATGCCAAGATCGATATCGATGCCGACCCAGAAGGGTACGCTGCGGCTGTTGCTAGGGC
GAACCCAAGCGCTCCGACCAGCGGAAGCAAGTACATTCTCCTCATGATGTTCAGTGCCTTCGGCTACCTCATGTCGGACGTGTGTGCCGACGCcATGGTC
GTCGAGCTTGctCagCGTGAGCCaCTTGCCGTTCGTGGTACGACTCAGTCAGcGATCTACAGCACGCGTACGGCGTTCAACATTGTTGGTCAGTTGATTG
TCGGATTTGCGTTCAACGGCCATGAGTACGGTGGTGACTTCGACTTCTCACTGAGCTTCCCAACACTCATGCTGATCATCGGTATCTGCATGATTCCAGT
CATTCCGATCACGTGGTTCTTCATCAAGGAAGAGAAGCACGAGGCTGCGGTATTCTCGGAGTACATGGCAGACCTTTGGCGCATGGTGCAGACGCGTGCT
GTGTATCAGATCATGTTCTACCAGTTCTTCGCCAACATGTTCACGAGTATCACGTACACAGCGTCGTCGCCAGTGCAGAGCATTCTGGTCAATGTCACGC
CGATCAACAACACGCTCTCAAGCATCATCAGTTCGTTCGCGTTCATGCTTGGTATCGCGGCCACGGGCAAGTACGGCCTTCACTGGAACTGGCGCTCGAT
GATCGTCTTTACTGGTGCTTTGGTGATCCTTCTTGACGGCCTCACGACGTTCATCACGGTCTGGAACGCTTTCCGTTCGCAGTGGTTCTGGCTCGGAGTG
CCAATCGCCGCCCAACTTCCGTACGGTGTCAACTTCCTCATTGGTACCTTTGTGATTGTCGAGATCGCTGACGAGGGTCACGAGGGAGCCATGTACGGTC
TTCTTACCACGGTCTCGAACCTTTCGTCGCCATTTGCGGCCACGCTCACCAAGATTATCGACCGCAACTGGGACTTGTCGAAtGAACGTATCAAGACCGA
CACGAACGACGTGCGTTGGGACCTGACGTACACGATCCTCATCATGTACGCAAGCAGTGTCTTCTCaTGGGTCTTCTTGTACTTCCTGCCACGTCAGAAG
GAAGAGACCCAAGAGCTTAAGCGCAACGGTGGCTCCAACAAGCTCATTGGCTTCGTGACCGTTGTCTTCGCGTTCTTCGCGCTCGTgTGGTCGGTCATGA
CCAACCTCATGGGTATCTTCGACAGCACATCTTGTCTTATCATTGCCGGTGGcGACGGCTGCTAAGCGTCTA