Description :
From Genome Similarity Track
Location :
contig_22:266989- 294351
Transcript NameFunction/comments
g4753.t1hypothetical protein PPTG_09034
g4754.t1Thioredoxinlike protein
g4755.t1hypothetical protein PHMEG_00023906
g4756.t1hypothetical protein, variant 3
g4757.t1hypothetical protein F442_04852
g4758.t1PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
27362 bases(100 bases per row)
AGGTCGTACCTGATGCGCGAGACGCTCTGCTTTCGATGCATGCCCAGAACATCGGTGTCCTGGGCGTATTCGGCCCTGCAGCGACTGGAAAACGCCTGCT
ACTCAATACTCTGCTGCAGCCTCAAGATGTGGACTTTTCCGCTGCCTCTGAGGACAGAAACGACGTGCTTCTGTGGCTGTGGGTGCCTCAAGAAGATGCA
CTAAAGACTGATGACAAGGCTCGCGTTGTTCTGGCCGCTGGGGCAGCTCTGCAGTCTGAGAACGACCCAGGACACAGAGAACCACAAGTTGGCGCTGCTA
CTGCTGCTCTCTTCCGCGCTACTGTACAACACAGACGGAGAGATCAACGCTGAAGCTATAGGCAGGCTGCAGTGGCTGGAGAAGGTGGCTCAAGTGCTGA
GGATCAAGGGCATGCAGGATGAAGAGGCCGTCGGTGAGAGACCTTCGGAATGGTTCTGTTTTTCTGCCTTGTGGCGACGCTAACAGCTGATTATCTTTAT
GTTGTGCTGGTGCAGCTGGTGAGTTCCATGCGCATGCCCCCAAGTTCATCTGGTTGACGAGGAACTTCAAGGTCAAGTGGCTCAAAGATACGGAAGGACA
GAAGTTGACGTCCATGGAGTATTTTGAGCAGTGTCTCGCGCCGGAGGGAGGCTACGGAGATGCTGCTACCAAAAGAAACATGATGCGGATGTACTTGGAG
TCGTACTTTCCGGTCAGGGATTGTGTGGCGCTGAGCCGTGCAGTGGAAGGCAACGGAACGGAGATTGTGCCACCTGGGACAGCCCGGAGCGAACTGCGCA
CACAGTTTGTCGAGGCTGTGGACGAGATTTACGCAAACTATTTGTCGGACAAGGCTCAGCGGCTTCCGGCGAAGGAATTGATGGGACATAAGCTGCGCTC
CGAGCAGTTTGTAGCTGTCCTTGAGGCGTACGTGGACATGATGAATGCCAGTCTGCTGCCGACGATGCAGAAGGCGTCGAATGCACTGTTGGAGCAAGAG
GTTGCAGAAGCCTTTGAAATAGCGAAGCAAACGTACACAGCAGAAATGCAGGTGGCGAAGAGTCCCGGTCAAGAAGATGACATGAGTGGCACCGGTGAGA
AAGTCCCTAACGCGCGGTGTCTACAGTTGGCTCATTTTCGTGGAATTCAGGCGGCCATGGCCATATCCGTGAGGTGCGCTCACACCTCCCGGAGAGACTG
CAGAAAACGCTGTTCAAGGACAACTTGGAGGGTTGGGAGGTGCAGGTAAATCGTGACTTCCAAGAAACTTTGGAGCGTAACACCACGCTGTCAGCAGAAA
TTTGCTCCAAAATCCTCGAGCGAGTTCTTCCGCAGAACCTCGCGGCTGTGGCCACTGAGCTCGCTGAACGACCACGAGAAGACTTTTCCGATGGTCTGAT
TCGACTGTTGACGCAGTACAAGTCAGACTTGCGGAGCGCACTAGATGAGTACGCTCAGCAAGGCAGCGGACCAGCTGTAGATACCCTCCTAGAGGAGGCG
CTGTTGCAGTCTGTACGCGCTTCCATTCAAAAGTGGGGCGCGACGGTGATCCACCAGTACCAGAAGCACATGCGGAGTTGGCAGGAGGAGAAAGAGCAAC
TTGACAAATTGCATGGTCTGGCCAAGGTACAAGGCACTGACACAGCCACTTCCGCAAATGAACAAAAGCGGTCTTATGAGCAGCAATTGGCGCAGGCTAC
GGAGCAGCTCTCTGAACTGCGTCGTGTGTCCACAGCGAACTCAACAGCAAAAGAGTGAGCTGGAACGCCTGACTACAGAGATCACAACAATGAACTTGAA
GCATGAAGTGCGGGTGAAAAACGCGGAGAGCGACCTTGCTTGGGCTCGCAGTCGGACGGAAGAGCTGGAAAAGACTTTTGCAGCGGATCGCCAGCGCAAG
GAACTAATCTCGGTGGCTGCCGCTCAAGTTTTAGAAAAGCAGCGCAGCTTTCACAAGGAAGAGCGTTCGTTGCTTGTACAGCAAAAGGAATTGATGGCGC
AGATTGTCCAGTTGGAGCGTGAAGTGGTGCAAAAGAAGACAAAGCACACGCAGAAGGTGTTTGCACTGAAAAATGAGCAAGCCAAGAAGCTGGATGGTAT
GCGACCGAGCAGGCCAAGTTCGAGCGGCAGTTAAAGTCTCAGGCAAAGAAGGACCTGAGCTCGCTCAAGCTCGCGCACGAAAAGGAGAAGAAAGCCATTC
AGGCGGAAGACACTGCTCTGGATAAAGAGCTGGCAGATATTCACGAGAAGTTGGCGATATTCGTAGCTGAAGAGGAGAGGCTAGAGCCTCCGCTGCTGCT
AGTCGCGATTTTTTCAAGTCGATGCCCATGATATCGCTCCCATTGATGCAAGCTCCCGCTCCTGCTGCGGGTGAACATCAGCCAGCGAAGCGCTCTGCTA
AAGCCACGACGCCGACATACCCGACAATTCCTGTCCGATTCGGTTCCGCAGATGACACCTCCTCTAGCTCTGCAAGCCCGACCGCTCGTACTGACGTCCC
GCAGAGTAGCGATATGTGCAGACAATCCTGAAGAGCCAAGCGCAGCATCAACAGTGTGCTAGCGCATAGCTGTCCATTACGCGAAATGGAACTGCGTGCT
GTTTGCCAACGACTTTTTACACAGGAAATAGCGCTCATGCGCGTTGCAGTTATTTTGCTGTTGCTTTGCTCGAGGGCGGTACGTAAGGTCTCTGCGTGTA
CCATTTACCCGTTTTGATCTACCGAGAAGTCTGTGCATGCCTCAAGAATGCCCGAGACCCGCTCCTCGCCTGTTGCGTGCTTGGTCGTGACGACATCGGG
ACGCATACTCTTGCTGTGGGATCAAGATGACACGCTGCCCTTCCGGTACCCGCAGCTTGCGATGCTGCTCGCCAGCCTTTTCCACTACGCACAGGCACAA
TCGTTTGGCCACCTAGAGCTGCAAAATGGCTTCACGGTGTTGGTCTCTTCACATGTGGAAGCGCAAATCTCGGTCGGTGTCATTTGTGCTACACCGCCAG
CATCAGGGCGTAACCACGGTGAATTCTCAGCAGAAGTTGCGCCGCTGCAATTGGGCCGATTCAAGAGTTTGCTTATCCTGCAGGAGTTCGTGCGGTGCTA
TCGAGGTGACATCGAGCGGTTAGCAGTGGAGAGTGTCGCGCACGCCAGACTGATGGCGGAAGAGTATACGCTCACTAGCGCTCTGGGCGGGTTTCAAGAC
GACTGCGAAGGCACCCTGGACGAATTCGTCGCCTTCCAAAGCGATTTTGTTACCCCTGTGATGGAAACTACCGCCGAGGCCTCCTGAACTCGATCATGTC
GTGGAGTCACGATAGCGCAGTTTTCTTGATGCAGAACTCTTCGGCTATTCGAGTGGCGCGGGGTTTTCTCATGAACGCTGAGACCGGAGATGTAGTATTT
TCGACACAGCCAGCGTCAGACGCCGACTTCTTCGGACAAGACCCAGTATCTCGGAGACTGCATCATCTCCACAAAAGTGCAAGGGTCCAGCAGTTAATAA
ATCGTGTCGCCAAAGCACTGCACGAAAGCGCTCCTGTCTTGATCCAAGCCACCCAGGACAACAATTCCGCTAGCGCTACAGTCATTGTGAGATTTACTCA
CCTGTCGGGTAACGATTTGACCGAGCTCTACGTAGCTCTGCGCGTGTTACCTGTGAGTCGACCTTGGTGTACCTCTGCACTGTCTTTACGTCTTGTCCCC
GCACTAATACGCGTTCATGCTTGCTGTGGTGTTGTCAATGTGAGCGAAGACAGGGGTGTTCTCGTCTGGTCGTCTTCTATGGCGACAACGAGCTGTTTCG
AGGCCGACAAAGCGATTGCTCTCTTCAGGGAAACTCACCAGGCTTTGGCAGCTCACCCAAGCGGTAAACGAATGCTGAACGTTCTGCAAGACCCGTCGGT
AGATATAGAGCTGCATGTCGGCTCTGACGGTGCACCGGAAGAAGTCTGGACAGCGATGGCTATGTTGGTGCAGCCGTTAACGGTCACGTGGCCGGCCTCC
ACAACTGCTGCTGTAAAACCCCACTGTGCAGGTACGCACTTTCATGACGAACCCATCGATTCGAAGCCATACGCGAAGCTAAGCACGCCTTCAAGATTGC
CGCAACACACGGAATAAACCTGGTTAGAAACCCAATCGAGCTCACATTGAAAACAAAACTGCAGAACAAGGTCAACGAGTTAGTACTCCGAAGCATTTCA
TAGATACCCACGATGCAGATGCTGGCCCTTCGTCGTCGGCGGCACTTCTTACATTCTAGTCGAGATACATGCGCTTTGCCAATATCTGGTCGCGAATCCT
TCGTGTGAACCATGAGCTGTCGCTCGGAATCGAGGTCTCGCGAAGCACTTTTCGCCCACCTTCCTCTTCTTCGCAAAGCAGACGCGTGACATCAATAACA
ACACGGACAGCACCTGCACATTCACGCAAAACGAGGTCAGTCCATTGAATCGATCAGCACTGGCCTTCTGAACTGCGTGTCGTACTTGTTACGAATGCTG
CCTGCCACGAGCCTCGCTCTGACAGCTTGGGGGCCTCCAGAGCCACTGGGATGGCCAAGTCGCGACAGGCCTTCAGCACCAACTCTCTGGTGCTGCCTTC
CAACACACCCTCACCCGCCGTGAACAGCGCACCATCTTTCACTGCAACCGTCAGAAGCAAGTAAACAAACCATTACATTAGGACTCGCAACATTTCGTCC
CCTTTCAGATTCATACCAACGAAAAGTTCGTGATGAGCCCTTCCAGCAGCAACCTGTCGCCATTTGGCCCGCGTTTACTCAGCAGCACCTCGTGGATCGG
CTCGCCTCGAGTCTCCACCAACTGAGCCACGTGCTTCTCAATGGGTACGCGGTTTTGGATCCACTGTGTGTGTTTGCATTTGGCCTTCTCACGGCCTTCT
CCATACACCAGCACAGTCGATGCCAGGCACTTGGGCTGTGGCATCGGACAGATATGTACCGCGACGCCGTAGGCCGCAGCGTCCGGCATCGGGTACCAGA
GCACAGACAGCATCCCGTCCACCACAGTCTCCATGGACGTCCACTTTGTCAACACAGTGGCCGTCAAGATCTGTACCATCTTCAACCTGTCCAACTTGAC
ATTTTCTTTGTCGAAGCTGGTCTACCATAGCGAGACCAGTTGACAGTCGTTGCAAGTGGAAGGACCATTCTACCAGCTTCTTTGTGGACACATCCTCTGA
CGCCTTCGCTCTCGCGCACGTGTACACCCCCGCAGGTCGCGACTGCAGGAACATCTTGGCAGAAGGGAAGTCCTCACACTCACGCACGACAACCGCCTTC
AAGAGTTCTGCATCCGCCGCCACAGCGTCTTGAATCTCCGCCACGAGCGCCATCATCCACCTCGAAGTCGAGAGTGTACACTATATGTTGTCTTACGTAC
GATTGTTCCCCGTCTAAACCGATCTGCGCGCCTGGCCCCACAATTCCAGGAGAAGTGAACGGACCACCAGGATCATGCTGCGTCGCTCTTCCCACGTGCT
CCTGACCTCTGCGGCGCGCGTCTGCGCCCCTCGCGCGGCTGCGGCCGTGGCCAACACGCTGCACCTGCAGAGCGCGCGCTTCTCGACTATCTACGACCAC
CGGACGCCGTTTGAGGTGCGTCTCCAGCGGTGAAATAGCTCAATCTGACGCTAATTCACCTCTTTTTGACGCTAATCGCGAACTAGGACGTGAACCGCCA
CCGCAGCGACGCCGAACAGCGGATCGCCAAGGTGCCAATCGTGGAGGTGGCCAACAGCGTGGCGGTGTGCGACGGCGGCGGCGGCGCGCTGGGCCACCCC
GTGGAGTACATCCAGCTGGACACGCGCAAGCACAACACCCCGCAGACGTGCAAGTACTGCGGTGTGCGGTACAAGATGAAGGAGGGCTACCACGGCGGTC
ACTAAGGCTGCAATTGGCAGCTTGAGTTCATTGAGTTGGGGGCTTTGACAGGAGCTTAGCTGTTGAGGAGCGCTTGCTGACGGACAACCGAGAGAAGCAG
CCCAATCAAGTAAATACAACAAAGACGAAGGAGACAAATGAGGGTGTCGTTGCTGTTGTTGAAGTGCAGACTTGCAACTGTACCACCGAATGTCAGTCAC
AAGATGCCTTCTGGTTTTACGTGCATTTGACTGTACTCAGTTTGAAGCATACGTGCAGTTTTCATAGATATTACCGCGATCAAGACGACGGCGAGGTCGA
TAGCGTATCGTCGGAGATGTCCAAGGTGTCCATGTAGCGCACGATGGCGCGGTAACGGAACTCGCCTTCTCGGCGCATCTGCCCGTGCTCCATGTTGTCC
AAATGATCCTTCACGAGGGTCAGCAGCCCCACCAGGTAGTTGCGCGTCACCTCGGGCGTCTGCATTTCAAAAAAGTACAAATACTGCACAAAACAAAACA
AAAAAGTAGAGTGAGTGTCGGCCAGGCAAGCAATGCAGCCATGGCAACGTACGGCCTCTAGAATCTCCAGGAAAAGGGGGACTTGGTTTGACGTTGTGTC
CTTGATCGCATCCGCAATGCGCAGCGACCGCTGAAGGCATTCCCTAACGCGTTTGCCATCTTGTTGGGAGGGGTGCTGCAAGACAAAAGAGCGATGAGTA
CAATCAGTACAGGAACGTCGGCACACTCACATCAGCGGAGACCCCCTTTTCACTCTTCAACGTCACTCACCCAAAAGAGATGCGCGCAATTCAACACCAT
CAAAGCTTGTTCGTTCTTCTTGAGAAGTCGGGCGGCGTATTGTGTGGTCTTGGTAGCGAGAACCTCATAGTTGGCGCTCGAAAGGTTGCGGGTGGAACGC
AGTGACGCCACCATCAGTTCTAGTGCGCGCCACTGCTCACGTGCAAGCGTAATTTGGTCCTCGTACACAATGAAAGCTTGCGTAATGAACTCATACGCGA
CTGCCTCAAATGCACAGCCATCGGCTACCATAGCACACTGCAGAAACAAGTGGACGCACGAAACAGACAGCGCATCCTGCTTGGAAGCCAACGCGGTCAC
CATTTCATGAACGAATTGCAGGACTTCACGCGGAGTTGTAACAAACGTCTTGGAATTCCCCACCGAAGCAGCACTCTCTGACTCCGCCTTGGTCTCTTGG
CCCTGAGTTTGAGTCTTCTCCTGAGAGTGGGCGGCTAGGTCCCTAGCGAGAGCCAGCGACTGGTAGATTAACGGTACAAGCGTGAAACGAATACGAAAGA
CTCCACTCTGCAGAAATGCACGTCGTGCTACAGAAAACACGCGAAATTTGACGTCAAGGTCATCGTTGGCCACCAGGTGTACAACCTTTGCCAGCGTTTG
CTGCTCAGCTTCAAAAATCTCAGCACTCTTTTTTCCCGTTTCCGCTGTGGTTGTTGGGGGCGGCGATTGCAATTCATTGGGGTCGTCTCGTACTAGTGGC
GAAAGCACCTGCAGCAAGAAGTCCATTTGTTGTTCGTTGTGCACACGCTGGTGCCGCGCAAGTAGCACACGATCCACGCTAGGGCTACATCTTTCCACGC
GCCTTGCCATGGCATCAGAGCAAGCATCTCACGCAATACTGGCACTTGCATCAGATCCTGGATGGAGAGTGCTCTCAGAAGCGTCAGCGCAAGAGACTCC
AGCTGTGAAACCACAAGCTGCCGCACTTGCTTATCCTTGTCAACACGCCACGCTGTTCGCTCTCGAAGAAATTCTAAGCATCCTGAAACTATTTGCTGTA
GCGCTTCCGTAGTGTCTGAGTTTTTGGCCTTGCTGGTACCCAGCCACGTGAGAGCGAACGTAGCAAACGTCACGAAAAAGGGCAATACGGACGCCAGGTG
TGCGTCACCACCACCTTGGCTTGGAGTTTCTCCACTTCCAACAACATACCGCGACGAGCGTAGCAGCAACTTGGAAGCCGTAGCCATCACCTGTTTGAAC
ACTTTGAACCCCTCTTGCTGTTCCTGCTCAAGCTTGGTCCGACCATCTACCTCCGCTTCATGTTGTCCTGTGTTGGCCACACTAGCCTGCGTTTCTCGGA
ATTTGGTAAGGCGCTCAAGAAGCGCTGTCAGGATCAACGCGACGTCAACGTTTTCCTGCAGTTTGTCCATCGCCTCTAGTAGCCTCTCAAGGTTCTGCAG
GTGGAACTCATCCGGGAAGACCTGAATGATGCAGTCCAGCAGATACTGCTGCGCCATGGAATCTTTACATGCAAGCACAACGTCATCCAGGAGTCTAGGC
AGCACCTGTTCAGCGTACACACTGCGCGTAACCCCCTCCATCTGACTAAGCCGCACAAGACTCGTCCCAACTAGAAGTCGCAGCTCCATCCGCTCCTTCT
CTCGAACAGCCAGGGGCCTGGATCCGCCAATCTTTTGGTGCTGCAGTCGAATCCAAAGCTGGTTTGTCTCCCGTAAATTCTGCAGCAAGAAATCGATGGC
GTCGCTGACTGTGCCACCGCCCGATTGCTCGTACACTGATCCTGTGTCCGGGAGCTTGTCACGGACACTAAGAGACAAATAGTGCCTCAGAAAGAGTCCA
CGCAGCGGATACTGCACTCCTTTGGTCATCTCCACCAGGTCCGTCAGCACGTCACGAGCTGGCGCCTCCCTCGATTTGATGTACACCGAGCCCACCGTCA
CCAGCAAGTAGCTGCACCACAAACAGCCATAAAGTAGTAGTACTATACTACATTGGTACCGAGTACTACTAGTATGTGGCTCGTACAGTCTCGGCAGCAC
GTTACCGCTGCTTTGGACCCGCTCGTACAGCACGCGCATGGAGGCGCCCGCCTGCTGCTGTTCGTCCACGTAGCTCTCAAAGTGGCGAGCTCGTCCAGCA
CCTGCATGTCTAGGGAAATAGTACCATACTCTATTAGTGTACAGCCTGCTGTGTATTGACTAATATGGATGTGAAGTCATTACAGAGCTGGTAGTAGTTC
TTGGGGGACAGCAGACTCGTGCGCAGCTCGCGCAGCACTTCGGCCGCGTGCTTGAGCACCGCCGGCTGGTCCCCGGTGTCCACTGCGCGTTGCATGCGAA
AACCCTGGTCGCGCACGGTCTGCAGCGCCTCGCGCAGCAGGTCCTCCTCGCCCTGCTCGTCCAAGACGAAGCCCCCAAGCGCCATCTCGAAGAAAGATTC
TTCAAGTGAAATATTACGAAATCAATTCGATTCCCACTTCATAATGTAGAATCAAGGACGTTTTGTTTCTTCTAGATGCTATTTACGTTCCCAGTAAAAC
GCGTTTTTAACGCGGCTGATTTATATGAGCAAATAAATTAGAGCGCAGCCGACATGGCGGGTTCGAAAAAGTGTTCGATAAATAAGTCCTCTCGAGAGCT
ATGGGGCGTCTAATGCTGTCGCTAGGAGGGGTTGGTACCGGTACGCGTCGACGGCGTCTTCTTCCAGGCTCGGCTGGGGTTGGTTGCTACGACTCCGCGG
GGATGACTACGGTAGCTTGAATCGGTCTAGATCTTGGGGGCGAAGACCTTGACCATACGGCTACGCAGGGCGGCGAGCACCACGACCTCCTCGCGCTGGC
GCACGCGATGCAGCTCCTTGGTGAGCGCGGCGATCAGACGCTGCATCCTGCTGTGCGAGGCCTGGTGCATGTGCAGCATGCCGCGGATGTGCGCCAGCAG
CTCGAGCTCCTCGTGGCGCTCCTCCTCGAGCTCCTCGAGCTCCTGCTCGCGGGCGGCCAGGCTGCCGTCGTCATGCGTGGGCGGCAGCACGCGCAGCGCG
TCGATATCGAGCTGCAGCTTGGCCATGAGCTCCTCGATCTCCTGCAGACGCGCCGAGGACTCGCTCACGTCGTCCTCGGACGTGAGCACGGCCTGCTTCT
CGGCCGCGACCTCTTCGCGGAGCCGCGCGAGCTGCGTGCGCAGGCACGCGAGTACATCGTCAGCTTGCGGGCGGCCTTCTCCAGCTGCGCCATGGGCGAG
AGGCGCAGACTGTTGCTCTTGGACGGCGCGGACATGGCTCGGTGGGCTGAATAATCTGTGTGCTGTGTGGGGCGCTGATTGAATAATGGGACGTCTCGAC
CGTGTCATGCACGCGCAGGACGCGAATGATGTGGCGACGAACAGCTGCACCCGCTCGCTGAACATGAACCTGGGCGCGGTGACCCTTCGTTGCCCGACAC
AGAAACCGCGATTGTAGGGTTTCATAATTTGGGAACCAGCAAACAAAAAGTGCGAGTGTCGAGTCTTTCCTGTGCGAACGAGGGCCTGTATTTAATAGCG
GAGCTCTTTCAGCGGTTGTGGTTCCCTTGTCAACAACAACGCTGCGGCGGTGCGCCGTTCGCGGAAGGCGGCGGCAACGGCCGAATCAGCCCGGGAAGTT
GCTGCCCGAGCGGGTCGGAGCCGCCTGCAAGGCACTCGTGACTCGTGACCGGGCCTCTTGTTCCACCTTGGAATGAATGATAGAGCGCCAGCAAATACAT
GCACATATATCGCTTGTCAAACCGAGACAGCTGCGGCATCAAGCTCCTGACTGCCCGCATCACCGATGGTGGACATTGCCGCGGGCATACCCACCAGGCG
GGCTTCTCCGTGGCGATGATTTATGACCGATTTCTGCTAACAGGCAGGGTGCCATGCAGGCACAGCTGGCACCGGGGACGCGCTTGAGGGGAATTACAGA
TCCGCGCGCAGTGACGCTTTCCGGCCGCAGTTGGAGGTGGCGCTCGCGCAGTTTGCATCAACGGCCTTGCGGTGGTCAGATGTAAATGAGCCTGCGGCCG
AAACTTCAGTCGGCACGACACCAGGAAAAGCCCCGCGGTCCGAATACATGTAGTTAGCTTCCAGCACGGCTTGAGCTCTGCATCTTGCATGTGCATTGCA
CTTTGCAACTTGCAGTGCAAGTGGCAACCGCCCGAAAGTGTAGGGCAGCGTCCGAAACAGTTTTTACAGATCCTAAATCTGATGTGCTAGATCCACAACC
CGCAGAATCTGGAAGCCAGATTTGTAGAACGTGTCCCAAACGGCTCAGGGCTCTACGAAAACCCCGCAGCAGTAGACAGCAGACCTGGGCAAGAGCTCAT
TCATTGCCAATGAGACATTGGCAACCGTACTCGTCTCGACAATGGGTCGTGGCCTTTGTGATGGGCCTGCATGCACGTAGCACACTGGAGGGCGGCACCA
TTTGCGTCTTGGCTGCTTTCACCAGCGCGACTGGAATCACGACAACCCCTGCACAGCGTCGTGCGAAACCAGAAGTCGGAGGGCTCTCTCTCGATCAACG
AAGCCCTGTTGTGTTTGTGCCGCACGCAGGACGACGACACCACCGGGTGATGGCGAGACAGAGGGAGAGACTGTCACGCCAGAGAGAAGCGAGGAAGACC
CGCTGCGATGGGATCGCTGCTGTTGCGGCAACAGGAGGCGACACTGTTAGCTTGAGATCGAGGACGACGACAGCATGAATCAAGCCATCACGGCGAGACT
CATCGGAGGGCGGACCTAAATCAGCGGGCGTGCGGCAGTGGGAGTTCAATTTAATTTAGAACGCCAAACTAGACTCAAACTTTGAAACGGCTCAGAATCT
ACGGTACAACTTCAGCACCGGCACACGATGAATGCACTCGGCAGCAAATTGTTAGCAATGGGATTGCACGTCCAAGTGTTGATCGTCTATTGATTCCAGT
TAAATCGCTTACAGCCACTTCCACTCCGGGCTCTCGCGCGTGATGCCGTCCACGAAGTCATCGAACGACTTGCCCGCAGCCTTACACAGTTTGCTCAGCT
TGCGGATCTGCTGCTTGCTAAGCGGGCGCAGCGTCTTGGGGTTCGTGAGCTTGGTGCGCTTCATGGAGCTGTTGACGTTGCTGCCCACCTTCTTCTCCTC
CTCGGGCTCCTCGTCGACCACCTTGCGGCCACCGCCGGCGCGGTATTCCTTCTCCTGCGCCTCGCCGATGATGGTCAGGCGGCCAGACTCCACCAGCCAC
TTCTCCGTGCACAGCGAGTTGTAGAACTCTTCACTGTGGGAAATCATGATGACACCACCAGCGTACTGGCGGATGCCGTCAGCCAGAGCGCCAAGTGCGG
CGCGGTCCAGGTAGTTCGTCGGCTCATCCAGCACCAGCAGGTGCGGGCGGTTCCACATCGCAGCAGCGATGACAAGCTTCACCTTCTGACCACCCGACAG
GCCGCGGATCTTGCCGTGGGTGCCGAACTCAGCCGGCAGGGCGAAGTCGTCGAGGTGACGTTGGATCTCCTTGGTCGTAAGCGGACGAAGGTCAAGGCCG
CCAGCCAGAGTCGCCTGACGGATATCTTCAGCCTCGGCAAGGGCACCCAGACCCATTTCCTGCAGCTGCTCCAGCGTGTAGCGCTTGTTGTGCTTCTCGT
TCAGGCCCACAATCTTACACTCGTACTCGAGCGTGCCACGCTTGCCCTTGGTACGGGACACGATCTTCTCAACCTGGCCCTGCTTCTTGCCCACGAGGTT
CTTCTCCTCCTCCGACTGCTTCAGGTTCACGTGGTCACCAAGCTCGCGATCAACGCCGTTCTCGCCACCGAAACGCCACTGGAAGTACTCCACAGGGCTG
CTCTCAAGGTGCTTCTCAACGTGATGGAACGAGTGCTGCGCCACGTACGCCAAACGCACAGCGTGGTGCTTCCAGAAGCTGCCCGTGTCGGGAGACGTCT
CCTGCACCAGCATCTTGATCAGCGTCGACTTGCCGGCACCGTTGACACCGATCACAGCCACGCGCGAGGCCAGACACAGCTTTACCGAAACATCAGCGAG
CTGAGGCTTGGAGGCACCCGGGTAGGTAAAAGTGGCGTTATCCAGCGTCAAGATACGGCGCGTCATGGAGTTGATGCCCTCCAGACGACCAGGCTCAGGC
AGGTTGAAAACCATGTCCGACGACTTCAGCTCGTAGTAGTGCTTTGCCTCCGGGTGGATGCTCACAAACTCGGACAGCGTCATCGGGTACAGCACCAGCT
TCTTCGACTCGTAGTGGAAAATATCCGTGCACACGTTGTCTAGGAAACCGGTGTCGTGAGAAACCAGCAGCACCGTCATCGTCTCGAGCGAGTTCAGGTA
GTCCACCAACCACTGCACAGCGTGCACGTCCAGGTGATTCGTGGGCTCGTCCAGCAGCAGGACGTCGGCGTTGTACAGCATCGCACGAGCCAGCGCCAGC
TTCATGCGCCAACCACCGGAGAGCGCATCGATCTCGCCGTCCAGCATCTTCTGCGTGAAACCAATCTCCGTCAGGGTCTTCGTAACAGACTCAGGGGTCT
GGTGCGAAAGCTCGGGGGCCTTGCACATGGACTCCAGCAGACTTCCCTGGCTCTCGACAATGTCCTCATGCTGCACGTACACGGAGCGCAGGGTTTCTGG
GAGGCCCTCAATGGCACCAGTAGCCAGGTTGCGCATGAGCGTGGTCTTACCCACACCGTTCTTGCCGATCAGACCGTAGCGGTGGCCGCGAGTGAGACGC
AAGCGCGCGTTACGCAGCAGAATCTTACCACCGTAAGCCAGCGAGAAATCGAGGTCGCACACATCGTTCGGGTCCGTGGACTTCTCGCGCTCCTCACCCA
GACCGCCGCCAGCAGCACGCAGGGCCTCGCAAATGTGCTCGGCATCCTTGTCGTGCATGTGCGGCTTCAGGTAATCCATCACGATGGTGCGCCACTCCGA
TCCACGGTTCTGGGTAGCCAGCTCCGTGCACACATCGGTAACGTACTCCAGCGTGAAGTCGTTCAGGCCAGGGTGCGTCGGGCGGTCAAGCGTGTCGGTG
AACGCAGTAAAATGTTGTTCTCCAGCTTCTTGCGAATTTTCGATGGGGTCCTCCTCCATCGCCTCTCCATCACCGGCGGCGTGCACAAGATGAGCACGAG
CTTCCTTGGCGGCCTCGACGACCTCCTCGTCAATCAAGCGGTCGATCGCCGTATCGAGCTGCAGCAGCAGCGGCACGAACTGCATCACATCCGACGGACG
GACCACAAGACGGCACATGCTGTCGATAATCTTCGACGCCTTGCGCTTAAGCGACGAGCTGTGGATGCTCGTATCACGCAGCGCTTTGTGCAGCAGCGGC
GCAATCAGGGACAGCGTCGGCGCGTCCACGTTCGCCACAAAGGTGGTCGCCAGCAGGCTGTCAATGGCCTTCATGGTCTCCTCCGGGCGAGCAATGACAC
CCACAAGCGTGGGCACAAGCGGCACGACGTCGTCGTTGTTGATCTTGGAGCACACAGCAATCAGGGCGTCGATAGACGCAGCCTGGACCTGCTTCTTCGT
GTCCCAAACGTAGTCGGTGACAATGGGCATGATCTCCGGCAGCCAGCCAGACACCTCCTCACTCGCGGCCTCGCTTAGCGCTTTCAACAAGTTGAGGCCA
GCAACCTTGCTCTGCCAGTTACGCAACTCCAGCCCTGTAGATTTGCTTGAGAACTGAGTGGATAGCGAGCGGGTTCACCTCCTGCGCGATCGTCTTGGCC
AGAGTAGCCGCAGCGTTCTTGACAACGTGCTCCGAGTCGGCGTGGCGCTGCATAATGTTCGTCAGCTGCTCCACCATGACGGGCTCCATCACCGACGACA
GCTCCTCACTCTTGCACATGGCAATTAGAGCCAGCAGGGATCCTTCACGGGCCGTAGTTGGCTTGGCCACCAGGAACTTCTTCAGCTCGTCGAGAACATG
GATGCCAGCAGTGCTGGCGGGGCCGAGGACCTCCACGGCCGCCGCAATGTCAGCGGCAGCGGCGTGGCGCTCAGCCTTGGAGGAGAAGGCGGCAACAAGA
CGCGACAGGACGGCGTCTACTGCGCCGTGACGGCGTCCGCGTCCTCGAGCGCACGAAGCGCCTCGCGCTGCTCCTCAGACGCGAGCTCGCGGAACTCGTC
ACTCTCGTCGGACGAGGATGCGGACGTCTCAGAAGGCGGGGCGACGGCTTGTGGTGCACGGGCGGCACGGCCACGTTGAGAATGGGGGCCTTGGGCGCCA
CGAACTGCAGCGACGACGGCGCATGGTTCTCCTGCTCCAGCACGGAAGGCTTGTTCTGCGTCATGGCGGCCGTCAGCATGGCGTCGGCCGCGGCCTTACG
CGCGCGCTGTCCCTTGCCCATGGTGATCTGCAATAAATGTGTGAGGGGAGTGCGAGGATCGAGTGGGCTTGGTCGCCAATGCGGGAATGAGACACAGCAC
TAGCGACGGGTTCGCAAGACCACAGCAGCCAGCCAAATCCACTGAATCTGAAGTTGGCCGTTTCATAACGGCCTGTCGACGTCACTCGTTTGACATTATT
GACGGAGGTTGATCAAGCGAAATGCGATCAATGCCAATACTGGAGTATAATAGAAGAAGTGTTTGATAGTTATAGTGCATGTTGCTATTACTCCTGTTGT
GGCAACCGACCCTTCGCGACATAGCGACGTTTTTTAACAAACCGCCGCCAGCCAATCGCTGGCGTTCGCGTCGCTGCTGGGTGGTCCAAGCAACGCGATC
CACCGAACATGTCGCGAAGTGCCGACCGCGGTGCTCGAGCTGGCCAGCGAAGCGACTGGCTTAGCGAGTATGCGCGCTGCTCACAATGTATTACATGCCT
AATTAAAGAAGCAGCTCTGCGCCGAGCGTCCCGTGGCAAAGTCTTATACGGCTGCCAGCGGACCCACAACGGCAGCATTTGGGGCGTTTCAAGTTATTTG
CGTTGATAGCGAAACAGCGGTGAAAACTATAAAAATAGAATTGAAAATGGTTGCCGTTCCCCTCGCAAGGAGGGGCACAGAAATTGGTTGAAGCCGCATT
TAGTAAACCAACCACACGGTAATCTTTAGTAAAAGGCGAAAGATTAATACGAATGTAGTTAATTTTGCGGAATGGTTTGCTTCAAAAAACTTTCGTATAC
CTATATACCACGGGAAACCATACGACCAAATGTCTATATTGATCGGTACTTTACCGGGTTTTGGTTGGAGCTTTGCCTTCGAGAGAAATGTTCGACCTCA
AACGAAACGACATGATACATTCCGATGATAGCCCTAGCATGAGCTTCATCAGCGCAGTGCGGTCGCTGCATTCCCCTCAACACGAAGATGCGAGGCTACA
GCTGGCGTTGTATTGTATTTAGTATAGTGCCCAGTGGTCCGTGGAAATGAGGGGAAATGAAATACTTTAGATTTGAAAACACGCACTATCAATAGTGTGA
CGTGAGTCACACAGCACCTTGGGCTTGGAAGTGCTAGAGAGTATACAAACACCAAGTGAACGGCAGTTTACTGATTCCCGGTCTGGGGGAACGGTTGACT
TGAACAACGTAGATTCTAGACTGATATTAGGCGGCTGCGAACAAAATGATACTAATGAACCATTTGGAGTTGTCAAGAATATCACCTCCACCGTTCTTCG
TGATGCCACACCTGTTCGATCCACTCAAGTATTACACGCTCATCGAACCATGCCTTGGTCTGCACCGAAAACGTTCAACCCACGGCTCACAGCAGTGAAG
GTAAATATTCCGTACTTATATTAATAAAAAATGAGTAGATCCGAGAATGAATAGTGCCATTAGTCTGCATTATGCGTGTCCGTACTTCCTACGATCGAGC
AGCTTCAACAGTGTTGACTGTTGGAAGAGCCCTGATCCACGTGGACCACAGCAAGGACTGCCGTCCGGAGGACCGGTTTGGCCGCCTCCTCCACGATTGG
GAAAGCGTTGGTGGCAGGACCCAAGTACAGGCATCAAGGACGCCAACGACAGCAAGTACGAGGTAAGCTAGCTAGCATTGTTCAGTCACTTCTCAATATA
CGACGGGCGTCTGACTACTACCAACAACCAACATAGACGTCCCACATATCCCAGACACATCAGCATTGCAAGAGTAGATGGGTCCATACGCTTTCGCTAG
TCCGTGTAGACCAGTTTTGCAGCCGAAAAAAATCTCTCGCACTCGTTCGAGTGAGTGGAATGAACGTCACATCAGTGTACACCGAGAGCTTCGAGACCTT
GCGTCTCTTACACGTGTGCTGGACAAAAGAGAGGTCCGAAGGGCGACGGCTGGGATGTTGCCTGGTCTACGCTGCGAAAGTCGGCATAGGCGACACGCCG
GCGGGACTAAGCGCCTCCCTTCGTTGTAGCTTGACGATGCCACACACTAGGGCCGTGTTGTTGACAATAACTGCAGTCGGCGAGAGGCGAGGCTTCAACT
GTGGATAACGCTGAATGACATGGTCAAACAGTCGTCGGGTGCCCGACAGCGTTAAGGACGAACGTTGCAGCGTCTTGGTGACCCCCTCAAAATCGATGAG
CACTTGAGAAGTGCATGCGTCTTTCAGACTGCTCTTCGCAGCAGGAGAGGCTGAATTCCATACTCGACTAGGACGCAATGCCCCAGGGAGTTGAGCGCAG
ACTCAAGTTTTGTATAGCGTTGAATCCTGGAATAGGTGCTAGACCAACGGGTGTCATTGCGAATGAGAGGTGGGAGGTCCGTTACACGTCGAAGGAAGCA
CCCCTTGACGGTTCGCAACTTATCATCAGGGCATGGATTTTGGACAGCAGCGTTTCATAGTCGCTCAGGTGTCATTTACAGCAAATTAAACCTGTGCGAA
GCGCATCCAACCATGGTAATGGCGCCTCACGACTTCCAATGTATTGGTTCACGCTACATTGTCACGACCATGAAGTGGCCGCACCCCAGGGCCTGTTGTA
CCGCGACAGCGTATCGGCAATCAGATCAAAGAGGCTTTGAGCCTCAAGATCTTTCTCCACATCGAGAGGGCAGAGCACTAGAGTAGGAAGCGCCGAATGT
AGCAGTCAGTGTCGTCGTAGTAGTCGGAGCCACCCTGAGCTGGGCATGTCAGGATCGTTGAACACGGCGAAAATCGCGATGTAGTGACGACCGCTAAAGG
TGCATCCTTCGAGCACAATACCGAAAGACGGCGGGAGCTCTTCAGCAACCCTAGCCTCGGCAGACTTGAACACGCGCGCGAGGTACAACTTCAACGTTTT
TGTTAATCGGAGATAGTGCTGTATTTTTCTCGTCATCTTGCACTCGACAAAACTGAGGGGTAGACGGTCCACCACGACCCATTCACACCACCGGAAGATG
TCACGTGTCTTCTCATCGATGACACGCAGACGGAGTGCGTTGCGATCTTGGCGGCTTGAGAGGCATCTTCAAGATACGTCGGGTGGTTGGTTCGGAGACG
CGTTGTCAGGTTGGTATAGCCGTGCGCACTCGTGCACGTTTTTGAGCAAGTAGAGCACTTGAAATCCTCCCTCGACTTCTTGGTGAACATGGGGGTGTTG
GTGAGAGTATGGTTATTCGACAGCATAGTGGTAGAGGGTGGGTTGAGGCAGTGAGTTGAATGTAGAAAATCGAATTCTGATCAAATGACAAGATTCAAAA
AGTGTATTATTCCCCATGTCTAGCCTTGACTTTTCCTACCTCGACTTGATTGACATTAATTACAACGAGTGGAGGCATGCGATTGGCCTATTTAGGAAGT
GACTCAGTTTTGACTACTATACGGTGCCCAAGTCATGTGGAAAGCCACAACAACGACTGGTCTGTAGTTTACGGAAGTACTGATTGACTGAAATCGATAT
AGAGGCATGTCATTTGATAAAAAAAAAATGTATACCACATTATAATATGGTATAAGAACGCTAAAAAAATATTGTACAAACAAATAAATTATGAAATATT
ATATATGTAATATATTTTAAATTATTATTTTTTACGGATCACAGGCTCACAGTAACGGTTAACCTCATCATGGATTTCATTGTCAGGTTCCCCGGTGAGC
TCAAAGTGCGGCGGCAGCACGCGGCTATCCGCGCGCGCAAGAAGTGCTGCTGTGCAGCGAGAACTGCCCTTATCACCACCATTCGCTGGCACCTTCGTCA
CCCCAACGAAATCCACCGTTGTCTTGGCACCTACGTCGCAGTAGATAGCGGTTTGATCCATATTATAGAGCACGTACGCGGCGGGGTCGAAGTAGCAGCG
TCCAGGAAGTAATCCATTAGCATCTTCGTACCTCGCATGCAAACGCATCGCGCAGCGCCAGCAATTCGGGGTGTTTCTCTTCTCGGCGCTCACACGTGTT
TCGCTCGATGGCAGGAAGTCCTCGACAGTTTTGATCTTGAATTCAATTGTGTGGGCAAGCTTGATGCGGTGCTGCGGCATTTTACGTATATAAATGGCGT
CAGCATGCCAGCCTAAACGCCCCACCTAGTTTCGACAAAAATACTGCTGTCCACCCACCTACGTACATAATATCATTGGCCAATCAGAGACAACCGCAAA
CTTCTGAAATAATTGGCAGCTGGCAAAAGTGATTTAGAGTAGAGTGCCAGATCTATCAGACTTGTTGGTAATGGATTTCCGTTTGTTTTTCACGTACCTC
TCTGCCCCATTGATAAAAAACAGCAAGTGAGAGAAGAGCATCCATGGAAATATGTATTTCGCTAAATTATATAGGTATTGCGCTCTTAGCCAGTAAACCT
GAACAATGTATGGGCATTTCCAGGTTTCTGCCAGGTATGCAATTGCAGGATTATAAGGTGGTCTTCTTTTTAACTCACAGAAATAGTTTCGTTGTTCCTG
CAGCTCTGTGGTGAATATCACGATAATTATACACTTTCGATCGGTTAGAACAATTTTTAGCTGACGAGAAAAGATCGCTTAGGAGGAGGCGATACGTCTT
AGTGATTGAATTGTTCTTCTGCCCCATTTTTCATCTCACAAGAGTCTAAACCAACTGGTGTACCATGGATTTGTGGTCTTGGGACTGTGACGGGCCATAA
GCCTCGACAGCTACTTCCAGTTGGCGCTGCTGGCATGATGGCTTAGGAACACAGCGTCAAGCCTCTTCCAGATAACAGTCTCCATCCGGCTTTCCCTGCT
GGTTGGCTGAGGAGCAGCCGCAAGCAGACGAGACAAAGTGATTACTGAGACTACTTCAATATAGTTACTAAGGTTGTCGTTGGGCGGTTGGTCACTTCCA
CTTTTGGAGTCCGATAACAACCACCGCCCAACTATCCCTTACGAAAGCCATTCTTTTTAAGATAATTAAAAATGTAACTTCAGGTCCAGCCACTTCTACA
CCTTTGTATATCCAAAGTGGTGCGAGTCCATAGCAACTCGTTTTTTTACAAATTTGAAAATTGAAAACTGAAACTGAAAAGTGAGATTATTAATCGGGTT
GAATTCCCAGAGCAAAGCGGTAACAAGCCAGAGCAAAGCGGCAATACCTCGCCGGCGACCTCAACGAGTCGGGTTTAAGTGCCGTACTGCATGTCTTCCA
TGCGCTCAGCTGCTGCAACAATGCAACGCCATCTTGTTCACCAAACGGAGGTCCATGCAGCTAATGCATTGTCTGGCAGCGCGTTTCAAAATCCGCATGC
GGCCCTCGGCTATCTGGCCTCGAGGCCGACTTGCCACCAGTTCCTCTCGCGACAACGCCAGGTTCGCCTGGATTTGAGCCTTCAGGACGCTGAAGCAACC
CTCAATCGGGTTGCACGTCGGGGAGTATGGCGCTAAGCGGAGAAGAACGAGGTCATCGTGCTCGACGACCCGTTCTTCCGTTTGGCTGTGTGCTGGCGCG
TTATCCAGCACAACCACGATCTTCTTGCCCTCGAAATGCTCCTGAAACGTTGGTGAGGCCTTGGCGTTTTCGTAAATCTCGTCAACGAATGAGGCGGTGA
CATCCATGCGGATGCTGCCACGTTCTAGGCGGTGGTGAACCAACCCAACCTCCGTCGAGACGGCGCACTGAATCTGGAGATTGGCGCCCTTGGAAGGAGG
CAGCACAACCGTCGCTCGTTCGCCCTTTCGCGCGCGGCCTTGGCTGCGCTTGTAATAAACGTTAAAATTAGTCTCATCGTAGTAAACAACGAAATCGCCA
GCATCCATATGCTTGCGAAGGTCCATAGCAAACTGCTTGCGCTTGGTCTTGTTTACCTCGTTGTTACACGTCTGAGGCTCCACACGGACCTATATCGCAA
AAATATAAGCCATTAGAACATGAGGTGTTAACTGGAGTGCATGGCGACTTACAGCATCTTACCTGCTTCAGCGTGTACAGCATCCCCAGGAGTCTATCCG
ATATGGTCGATGTGCTGATGTTCACACCGAAGTCGAACAGAATCATGGCCTTCATGGCACGCAGCGTGTACGTGCAATCGTCGCTAAGGTACCCGTCGAG
AGCTGCCACTATCTCTGGGGTGCACTTGATGCAAGCGCTGCGTGCGCCTCCACGAGGCGATGGCTCTTCACGGCCACTGGCAACGATCCGACGGGCCGTC
GTTGGAGAAATGCCGTTGTGCTTGGCAACAAGCATCCAATCCTCACCAGCACGATGAGCCTCGAGAACACGACCGCGGGAGACAGCAGAGTGTGGCCTCC
TTGGCATGTTTGATGAGGGGGGAACGAGCTCCGCTGAAGACCGGAAATTGAGGAGTGAGATCTAAAACACGAGTGGCAGCGCAATGGACAAGCTTTCCCG
CCCATGCACCTCCAAGAAGCGCACTGAACCACCCGACGTCGTGTTTGGTTTTGGCGCGCAACCGACCGCCACCAATTTGGTTTGCGCAAACACTGCTTTG
CTGTCAACAAGTTCGCAAAGTAACAAAATTCTGCCGAAATTGTTGTGTTACTTTACGCCACTTCACCATATTGCTCTGGACTCGCACCACTTTGGACAGG
CAAAGGTGTAGTTCTGTTCCTCTGTTATTATGGTTCGTTCCAACGGCCCCATGACCGGTCTCAGTCCCTTTGTAAGGCCTAGACAACTTCACAGGGATAC
AACCGCATTGTTCAATGTACTCCTCTCCGCGACCAGGGTTTATGAAATTCTGATGAAGTTCGCGCTACTCTACTACCAAGGTTGATGAAATCCGAAGCCT
CCGCTCGTACATATCCAGATTCTGTCGACACAACAATACATAAAGAGTACGTACTGACACGCTGACGTAGAGCTAAAGCTTCAACGTTGTTATAGATCCA
TAGTTACTGTAGGGATGCGACCCTGCCAAAACCAATTCTATAATCTTATTTTCATAATTAAAACATTTCATGTGTCTTGTAGCGGGGCTACACATTCGGT
TCTTAGTGCAACATGCACTAAGGAATACATTCAGGTTGAACACTTCACAGGGTGGTCCACATTCATAGAAAAAGCGTGTGACTGGTAGAAAGTAACATCT
TTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTA
CAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAAT
TACTCCTACGCTTCCTCATACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGA
CCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGT
TGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGA
ACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACAC
CGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGC
TCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCT
ACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGC
AACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCAC
GTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAG
TTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGA
GTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACC
TGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATG
CGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGT
CATCCTGAAGGTAAGCTCGAAGAGAGAGATCTCTTCGTTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTG
ACTTCGAGGAGGTGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCT
TATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGG
TGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGC
ATGCGGCCCTCCACAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAGAAGATGTGAACCGAA
TCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGA
CACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAAATGC
TTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAA
GGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCT
CGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACGTGAGTGTCTTGACGCGTACGAGTATTGGTCTCCAATA
CAAGAAGATGAGGCTGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGAC
GCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGC
GAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGAC
GACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGTGGCCACTGCCGC
GTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGT
GAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATC
ATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACGGCGG
TAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCG
CTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCATACAGAGCATCTC
CGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGG
GGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGC
CACGTACTTTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTC
AGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGA
TTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTAC
CCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACG
CATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACC
TGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCAGGACGACTACA
CCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTC
GTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCAT
TGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTT
CTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGC
AGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGG
TATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATG
GTGTTTAGACACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCAT
GTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGG
AGCGACTGCTTGCCGATGGCGGAGTTCGCCATCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGC
GTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGA
CGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTA