Description :
From Genome Similarity Track
Location :
contig_24:266989- 268193
Transcript NameFunction/comments
g4558.t1hypothetical protein PHYSODRAFT_286397
g4559.t1hypothetical protein PHYSODRAFT_334052

Sequence
1204 bases(100 bases per row)
GTCGTCCTCCTTGGTCAGGTTGAACAGCTTGCGGATGTTCGAGGCACGCTTGGGGCCAAGACGACGCGGGATCTGCACGTCGGTCAGGCCGGGGACGTCA
GCCTCGCCGGCCTTGACGACCACCAGGTTGAGCACCGAAAGGTCCGGGCCGACGATGCAGCCGCGCACCGACTTGCGCTTGCGCTCACCCTTGCGGCGGG
GACGGTAGCACGTCTTGCCCTTGGCGAGCAGAAGACGGGCACGGCCGTTGGACAGGACGCCCTGCTTCATGGGGAAACCCTGCTTGTCGTTACCGCCCGA
CACGCGGAAGATGAAGCCCTTGAACTCGTCGCCGAGCACCTCGCCCTCAACCTCCTGGGAGATACGCTTGTCGTAGAACGCGCGGAGCTTGTGCTCGTCA
TCGACTTCGAGCACCTTCTGGGCACCCGTCAGGGGGTTAGCAATGTTGAGCTTCATGGTGGAGAATCTGCACGAATCACGACTTCGTTAATTTCGCGTTA
CACCAAGTAATTGGGGGCTGTTTGCTGCTGGCAGAGTCATCGACGGGTAGCTACGCGTCCCGCTACGCGATTGACACAACGGCAGCCTCCAATTTGACTG
CCAGCAGCTACAGAAGAAAAGCGCGCGAACAGATCCGCTTTCGTACCTCACAAGACAATAAGGACAATGGTAGTAGCGACTGGATTGGCCCCACCACCAA
CGCTCACAGGCAGCCTTCACGGCCAACCAAGTGCCTGCTCTTTGGAAAACGTCAGTTGAGCTATGCTACACACATTAATCAGACAAGTTTTTCCCGCATC
TTCATAATTGTAGATATATTTTTCGTCATTAATATCGGGATCCGAAACTAGTGCTAGTTTCGGTAGCAGATAATAGTGCTAGTTTCGGTACGCGTCGCCA
CCGCTCGTTTGGACACCTTTGCGAAGAGCTCACATTGCAATCCAAGCAACATGGGCAATCAAGTGAGCACTCCCGCTGCCGCGGACAAGACCAAGCAGGG
CAGCTGTCCAGTGCAGCACGACTCCACGAAGACGGCGCCTGAAGGATGCCCCGTGCAGCATGACGGCCCTAAGATCGAGGACTGCCCCGTGCAGCACGAC
AAGAAGCCGGTGGTGGCCGACGCCATGGCTGGCGGTTGCCCCGTCGTGAAGGATGGCAAGGGAAGCGCGGAGGTCTACAACGTCTACGGTCAGCGCATTG
ACCC