Description :
From Genome Similarity Track
Location :
contig_184:26698- 28634
Transcript NameFunction/comments
g11958.t1hypothetical protein

Sequence
1936 bases(100 bases per row)
GGTCCTGAGTGGTCTTCAAGTACTTCAAAATCCGCTTCGCAGCCACCCAGTGAGACTTGTTGTACCGCTCGCAAAACTTGGCCACTTCACCCACAGCTTG
AGCAATGTCCGGGCGCGTACAAGTTGCGAGGTACATCAAAGCCCCCACCAACTCGCGATACGGGTACCTGGGCACGAAATCTTCGTCTTCTGACGGCTTC
ACCAGCTTCGAGTTGCTGTCCGCTGGTGTGTGCACTGCCTTGCACTTTTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGA
CGATGGTCTTGTCGTCGCGGTTGCGGTGGATCTCGATGCCGAGACAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTT
GATCTCACCGATCTCCGCTTTCGTCCTGCTGAAGATCATGAGGTCGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACA
CACGGATCCGCCGCTGACCGATGGAAACCTTGGCCCTCCAGGTGCTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTT
GCATCAACAGGCACTTCTTGGTTGGGTTGACTTGGTCTTCAAATCCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGT
GTCCACATCCACATTTTCAGCCTCCATGTCTTCCTCTGCTGCAATCGCCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTG
TAGTCGACCCCTGGACGTTGCGTGAAGCCCTTCGCCACGAGACGAGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACT
TGCACCCGATCGCCTTCTTGTCTGACGGCATGTCCACCAACTTCCAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTC
GTCCTTGTACTTGCTCCGCATGACTTCATCGTACGACACCGCGCGCTCACCGTCGTCGTCTTCGGTGAGGAAGCAGTAGAGGGAATCGAACTCAGCCTCG
TAGTCGTCCAGGTTGAACTCACCCCTTCGAGTCCCGGGAAATTCGTCTTGGTAGCGCACGACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCT
CTTCGCCGTCTCTCCCTGGCGTGCTAGAGCCACGCGTTGGCACAGATCCGGTCGGTCCGCTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGT
GCTGAAACCGTCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTTCTTCATCGTTGTCGATGATGTCGATCACCTCCTGGTTGCGCGTCTTCGCCATTGTG
ACCGGTGGCGCTTCAGCAAACGTCACACTCCTTGAAATCACGATCGATCCGTCGCTGGGGTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCGTAGCCGA
GAAACACGCACTTGATCCCCGAGTTGTCCAGCTTTTTGCGTTTCTGCTTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACG
TGGCGCCCTCTTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCCTCGCAC
CAGTACGACTTGTCCATCCCGCTCTCCCCAGCATGCAGCGTGTCATTTCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTA
AGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCGTTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACC
TTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAAC