Description :
From Genome Similarity Track
Location :
contig_54:266933- 268798
Transcript NameFunction/comments
g11287.t1hypothetical protein

Sequence
1865 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCTCATCCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCAT
GCATGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGT
GCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCTAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGC
GTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGCCAAGCCTTGGAAG
GCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGC
TTGTCATCTTCTTGCAGTGAGATTGACTCTCGCTGGGCAGCGATCTTCAATGCAGCGTGTCTGATGTCGACACGCTCAACCGCATCACCAGCAGGGCGCC
CCGCGCCTGCTGATCCGTCTAGTTTTTTGTTAGCCCGTGACGATACACAGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGA
GCGTAGTGACCAATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCCGTCGCACTCGAGAGGTCCATTGGTT
CGGGACCTCCCGACGGCCGTACCACCGGTCGTGGTATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAG
CGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTTCCATCTATAAGGCCTTTCATGAACGTGCCGACCTTTGTCGCCTCGTCAATC
GGATTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATC
GGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGC
CCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGTAGTGTCGACCTCGACA
AGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGACGGATGCCGACACCGAAGCTC
GAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGTTTC
TCCAATGACCGTCGACTGTCGTTGGAGGGCCCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCACAACATGCGTTGCAGACGTGTTTCGGCT
ACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACCAACAAGTGC
TACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATAC
TTGTATCCACAAGTATACTTAAACTAAGACAAAGGAACCGAACAATAGCTTTGGTGCCAATGAGA