Description :
From Genome Similarity Track
Location :
Scaffold_65:266922- 268884
Sequence
1962 bases(100 bases per row)
GCTTCAGTAGATTCCTTTCGACTTTAGGATAAACTCTACAATGAGTACCTATAGACTTCCTGTAGTGGTTTGATCTCGCAGGTTCTAAGTGGGTGGCTTC
AAAGCGAATAATAGGTTTCGGATCTTCGCTCGCGCAGCTAACTTTAAGAATCTCGATAGCAAAATACGGCCGTCTACCGAAGTGAAGCCGCCAAGAATAA
CAGTCAGCAATCAGGGGTATGGCTTTCTAGTGCGTGTTTTGGCGCCTCTTTGGCAAAAAGACGATGCACATCCTCATTGTAACGGGGCACGCCTTTGTGT
TGACTGAACACAAGGTTGTGTGCTCCCGACGTCACGTACACGTGGTGTGAGGAAGCGCAAGCAAAGTAAACAGAACTAGAAAGCTCTGTTTAAGGAAAAA
GTAGAACTGTATTTAACATATTTACGTTTCTTTGTAAATCGTCTTTGTCTTGATCTAACTATATTAAACTGAAACCTCCTATATGGGTTTCTTGCTCACC
ACCCATTGCGCGCGTCCAGCAGCGATTAGTGGTTAATTTGGTTGATGTTGTATCTACTTCAACCAAAAGTGAAGCACCCCAGAATATTACCTCCAGAATA
TTACCCCCGGAGGTAATATTCTGCCAACATCACCTCTTCTCAAGTGGTGTTGATTGAATATCATCAAAATAGATAATATTCAAAACTTGATACATTCGCA
TCAATTTTATATAACGGGCCCACCCCGTTACATCACCCCCCTTCATTATCAGTCACTGTAGTGAGTGATTTAATCGATTGGTGATAGAGTGACTACAGGT
CTTGTCGCTTCTGGGGGAAAGAGAGCACTTGTTGGTATTTTCTTTCTCATTCTAACCTTCAGCGCATGAGGAGTTCGTCTATGCGCTGCGCGAGCAAGGC
CGCGTCTGAAGCGGCTGCACGGATGCGTGCAGCCGGTGAAAAAGCTACTCCAGACTCGGCAGCAGGTGCTTCATCGCCTGCTGCTGCAAATGAACAGCCT
GCAACATCCAATGTTGCAGGTTCACGTGGTCAGCCACGTGCAGCTTCTTCATTCGCAGCTTCGGCTGCGGGTGGTAGTCCCATGGACGTCGACCCCGAAT
TAGAGGTTGACTATTCGGGCGAGTTGGACTCCCCGTCCGACTCAAAGTCGCCCCCAAAGCCCAGCCATAACGCTGCGGGTGCGGAAACGACAAATGCTGT
TCCTCGTGGCAATCTCGAATTGCGCCGTGATATGTTCGGCTCATCCGACGAGTCTGAGCACTCATCGCGGGGATCGAACCGATCACGCTCGCATTCGTAT
GATGCGAGTGATAAGCATGAGGACATTAGTCATCGTGATTTATGCCAATGACTCTTCGCGGAGTCATCACAGCCGTAGCAATACCAGTTATTGCGGCGAT
CATAGTGCCAGTATTTCTGTCGGCACTACGCAAGAGGAGCAGGATCGTAATGCGTCACGCTCTGCTCCTGATATCAAACCATGGATGCCATCCTTACGCA
ATCTGAGGGAGTGGTATGATTATACTACTGGGAGTTGTCGAATTCCACTCTTTGATTCGTCAAGACTCCATGATCCTGACGTCAGTGCGAAAGACTATCG
CACTGAGCATGAGTACTACATCGATGTCTTTTTCAGACATCGATGGTACCATGACAACCACAACCGAGATGAAATTTCGTTGGCGCAGGCGTGGAACTAT
TTCATCGGCAACATCGAAAATGTTGGCCGCGGGTCTTGGCTGGACAAACTTTTTGTAGCTCGCAATAGGTTTGAGCAGAAGTCGCCAACCGGTGCTCGAC
TTAAATTGCACCGATTATCTCGAGAGGAAGGTTTACCTTTCCTCTCGTGGGGAGAGAACTGTCAGAGTTGTGTCGACAACTCTGTTCGTGCCCCTAGGGA
GGCCTTCCTCCCTAATCAGCCCTACTGGAGGGCGCGCATCTCGTCCGAGATGTACCAAGGGA