Description :
From Genome Similarity Track
Location :
Scaffold_538:2669- 7841
Sequence
5172 bases(100 bases per row)
GGGGATCTCTATCAGAGACAATTTCCACTGGCAAACCATGTTGTCGAAAGACACGGTCGATAAACAGCTTCGCTGTACCTTCGGTATCAATAGAGTCCGG
CACTGCCGCTAGGTGAGCCATCTTGCTCAATCGGTCAACAAAGACCACAATGGCAGTATTGCCTTCCGAATCTTTCGGTAGGCCAAACACAAATTCCATA
CTCATGGACTTCCAACACCCAGTGGGTACAGGCAGACTAGCAAGCGGCGCCGCCGCATGTGCTGAGGGTTTTACCCGTTGACACGTTTCACACGTACGCA
CATAAGTGATCACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGCTCACTGAGCTATAGGTCTTCTCACGACTGAGATGACCACCTAAAGCGGTACC
ATGTACCTCATATAGTATTCGATACTTCAACTCATCATCATGAGGGACAGCGATACGAGGGTTACTCTCAATATCTTTGCGATAGCACAACAGGCCATTA
TCGATAGAATACCGATGTAGCCTCGCACGTAAACGTGCCGACAATTCTATGTCCGAGTCTTTAAACTCCTCGCTCCCAAGAGCACGTAGCAAAGGTACAC
ATTGTTTATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGACGATGACAGCGTAGTGACGTGAGTAATCTCATAGTCAGGTCGGCGCGATAGCGC
GTCAGCCAAAGCATTTTGCTTTCCTAGCTTATACTTCACTTCGAAGTTATACCCGGCAAAGAATGAAATCCAACGAGCCATTCTCTGAGAGAGATGCGGC
GACTGTGTCGTAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTGGAGCCAAGTAGATGTACTCTGAATTTGACTAGAGCGTACTTCATAG
CAAGTAGCTCTTTGTCATGAACTGGATATTTCTTTTCAGCAGCTTTGAGCTGTCGAGATTCGAATGCAATGACGCGTTCGCGTTCATCGACATCGATTTG
TAACAGAGCACTGCCTATGGCAAAGTCAGATGCGTCACAGACGACACTGCAAGGCCGATCAGGATCGGGTAAAGCCAGTATTGGTGCATGAAGGAGACTT
TCCTTAACTGCTTGAAAAGCCTCATGTTCGGTATTACTCCAACACCAATCCACATCCTTCTAAAGGAGATTGGATAATGGCCGAGCCCATATCTGCGTAA
TTCGCACTATACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTCGTTGGAACCGACCAATCGACTATGGCCCTTACCTTAG
CGGGGTCCGCTCGAAGGCCTGGCTTCCCAATGAAGCACCCCAGAAAGGGAATCTATTCTGCACCAAAGATGCATTTGTATACACTTTATTCGTGCGCATG
CACTCGAGCACCGCTCATAAATGATCAATGTAGTTATCCACATCAGTTCGACCGTTCGTTGCACGGCTATGGACAAAGATGTCATCAAAGTACGTTTGTG
CATAGCCTCGATGAGGTCTGGATAGTTGCGTCACCAGACAATTAAAAGTAGCCGGGCATTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCACA
CCGCTCGGGGTACTAACCGCTGTTAGTGGAATATCGCTTGCTTGCATGAGCAGCTGGTAATAACCATCGACTAAGTCGAGCGCTCTGTACAATGTACATC
CCACCATATTGTTCTGAAGAACGTCCTTTCTGGTTATTGGTGTCTGAGCCGGGATAGTGGCGGCATTGAGCTTATTATAAGCGTGCAAAATACGCCACTT
ACCATTAGGCTTTTTGACACAAAAAGTAGGTGTGGAATGGGGAGACTTACTCTCCCGCACTATTCCCGCCGCGTGCTTAGCACGAAAGAAATCGTCAATG
ACGTCACAATGTTCCTCAGGTAAAGGCCACTGCCGTGTTACGCATTATGTAGTTCCTGGAACTAGGTCAATTTCATGACGTACACCTCTATCGGGAGGTA
AGATAGATGACGGATTGTGACACACCACATCTTGAAATTCCTTTACCAAAGGATAGAAGGGATACAAAGGATCTTTAAGGATAGAGATCCACTCCGGGCA
CTGAGTGCCGCCTTGGTATCCTCTAGGACCGACTCATCCATTAATGAGGACGAGTTCAACTCAACATCGGGTCTAATGACCACTAATTCGGATAAATCTC
CTGCCTTCAAGGCCTGGCTAAACTCGCCATCAGACATTTCATCTAGCTCACAAAGAGCATTCAAAGATGGAAGGGTTTCCAGGCTAACATTGCTCTCAAC
CTGGCCAGTCACTTCGTTGACAAGTGTATATAGTGTATCACTATTGGCACTATGTGACGCACGGACGCCTGGCGCTTAACAGTTACCACCTGGCGTCCCG
GTCGTCTCTTCGATGAGACCTTACACCCCTCTGGGGTCGGAACAATAGTGTTCCCGTGGTTACTACTACTAGTAGTACGCTCTATACGAGAGCTGATGTC
ATTACCGACATTAAGTGTGGCGCCTTCAAGGCCGACCGCGCTCGGTGAATTTTCACGTGTCACCCCACACATATCAAAGCAATCACATCCTTGATAACTC
GGCCCTAGGCCAACCATGCTTTCAGCATGAAGTGACTCGTTATCACAACGAGTAACACTCAACGGAGTATGTGCCGTATCACTAATACTCAACGATCTAC
GCTCGGAATTCATGTTTTCAACATTGGAGTTAGCTAACTCAGACATTCCAATGTCTAGCCCATTGACATCTTCTTTCAAAGGCTCGCGCCAATAGTAATT
TTGTTGCCTATCAAAGGTGGGTTCATGACTTTCCAAAGCTTCGCTGGGAAAATTGCGCGTAGCGCCTAAGGTCTTCGACCTCCAATCAATCCATGGCTCA
TGTCGTTCAAGCCAAGCCATACCTAGGATGAGACCATATCTCGAGTCCAAATCAAGGACAAGACAGCGTTCAATGCTATCAAAGTCCAAAAACTTTATAC
CTAAGTTCAACGGAGGTACAGTGACACGACTTCCAGTCGCTAAACGAACCGTGATCGAATCACCTCATGCGCTGTAAGCGCTTCAGCATAACACTGACTT
TCCTCAAGGGAACGACGTCGAGAATAATTGCAAGACGACCCATAATTGATTAAAATCGACCAAGGCTTTTCAAAGCCTTTAACTTTCGCCTCAGCGACCA
ACAAGCCAGATTTGTATCCACACTCCATACCAGTAGGTATGGAACTCTTTTTTTGGGGCTAAGCCCTGTTCAACTCTACTTCCTAAAGGTGTTACAGAAC
CTAGTTCTTCCCCAGTAGGGCGCCCCGCGCCTACTGGGTGTCGGCATTTCCCCGTGCAATGCCAGATTTCTGGCTCGGTGTAGAGTGTTGACTCGTAGCC
TGGCGCTGTATACGTAAAGGGCAACCAGGCCGTAAGTGTTTAGTGCTTCCACACGTATAACACCGGCGTACAACACGTTGCTTCTCAGAAGCTTGAAGTT
CAGCTTCACCTTCATCTTCAGCATAGCTGAGGTCCATCGGTTCCGGTCTATTACCGGCTGGAGTACTCGTGTAGTTTACTATCGCAGAACGAGAGTTGTA
CCCATTCCAGCCAAGTCTGGCCGACCTGAAATTATGCTCAGCATTAAGAGCAATGCTCACAGCATCTTCAAATGTAGAGGGGTGAACCCGAAAGACTTCG
GTTCTGGAAATGCCAGTACGGAGACCCTGCATGAATATAGTCACATGGACTGCCTCAGGCAGAGGGTCAGACTATATAGCAGCCACGAGAGTTCTCATCT
CTTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGGTTGATAAAAAGCGTGAACGAACGCAATAAGCCTGGTTAGGTGGTGAAAACACCTGTACCAA
TTGTGACTGAAGCGACTCCCATGTGGGAAACGCTAAGTCGACCGACGTGCTACACGTCAAGGCCCATTTTCTAGCTCTTCCATCGAGCTTTGAGATAGCC
AGCGAGATCTGTTGATGGTCAAGCTTGATCAGGCCTGATCTCTTGACCCTCTCAATCTCACGGATCCAGAGGATGAGGTGTTCACCCTCCTTTCCTGAGT
AGACTTTAACTTCCACTCTAAGTGGACGAGGCCTAGCCTCTTCGTCTGGAACAGACACATAGCGTGTAGGCATAGCCGACGCCATTTGATCTTGGACCTG
CCCTAGAAGGGACGCTTCATACTGCAAGAAGCCCTCAACACGTGCAGTCAGCACCTCCGGGCCTTGCGATACAAGGCATTCCACATACTCTGGACCCAAA
GATGGGGTCAGCTTATCAAGCGCGACCTTTTGGGCCTCAGAGAGGGGAGTGGGGTTATCCATCCTCACAGAGGATCAGTCTTTAAAGACTCAGACGTAGA
TTGACTACGAGTGCAACCAAGTGTACCGGAGCTACACAGCTCCTTAAGTCTGAGGAATACTTAGTGGTCAAGAGCGATATTAGCTCTAATGAACTAGACT
CGATGAGTCAATAAGCGTAAAGCTTAAGGTCCCTGTTCCAGGGGACCGCACGATTCAGTGAATCTACAGCACTTAGTGCTCAAGAGTAGCTACCTCAGGG
AGATGTTGCTAACTCTTAACGATCAACGATCAGAGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAAGGTGAATTGAACTTTATTTACGTTTAAC
TCTATAGAATATCTTAATCCTAATATTACCTAATCTAGGCACTCATGTCCTAAATTACTATCTTTAATATCTTTCTTATCTTGTGGCTGACACCCGTCAG
CCCCTATAAACCGATAAGATATTCTATATCTCTTTTAGTGGGATACCATCCCGTGTGTCTAAGACACAGGGTATCGAGTACCCTACGATGTGTAACCCCT
TGACAGATGTGACGGCTCTCTTGGTTTCCTGGCTACTTGTCGGTGACACAATAGCGAACGTGTCCTCCAACTTTTGTGTCGGCCCTCCGGTACTCCCGCT
TTGCAACCGCTCGGAGTTGCCGCATACCTGTTTCCCGAAGCTCCTCGACACTGCCGTCGTGTAAGGGTGATCCCGTTACATAAAATTGGTACGAATGCAT
CAATTTTTGAATATTATCTATTTAGATGATATTCGATCAACACCACTTGCGAAGAAGTGATGTTGGCAGAAT