Description :
From Genome Similarity Track
Location :
Scaffold_1466:2669- 3852
Sequence
1183 bases(100 bases per row)
GGTCGAAGTGTCGTAGTATCGGTGCTGCCGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTTGGCCGCGGTGAGGTCACCCCCGGGCTGGAAGTCCTC
GTCCTTAAGCTGGTACAGCGCTGCTCCATAGACCGCGAAGTCTTGGATGAAGCGACTGTAATAGTTGAGTGCCCCAAGGAAGGACTGCATTCCTTTCCTC
GTTGACGGGAACGGAAGCTCGGCCACCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACTTTCTGCCGAGAATTCGTGGGACAGGAAGTCTACCTTGGACT
GCACAAAGATGCTCTTCGTGAAGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCGGCCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGC
ACCGAAACAGATATCATCCACGAATAACCGGCGACTGAATACTGGTGTCAACGAGGAGTCATCGGGCTCCCCGTTGGCGAACATGTCGGCGATAGGGCTG
CTGACCAGTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCAGTCGGCCTCGAACTTGGTCCGGAATGGCTTTGCCGTGCCAGTCGAAGCTTCGTTCA
CCCCAGCATGAGCTTCCTTGTCATGTTCTTCAGCTAGACGCATGCGCTCCGAGAATTTAAACCATCCTCCCGTCGGTTGGACGAAGCCCCAAAGCGCGTT
GTCAATCATGCGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCGAAGTGCCCCAGTGCGCAGACGAAAGCAGAGATCTTC
CGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAACCACAAGTACGCCTCCATGTCCGTCAGCAAGTCATCCACCA
GGGGCATGGCGTACTCCATAATCTCGGTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCGGATATCCACCCCATTCTTCTTCAGGACGATGACGAT
TGGCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAGCAGACCCTTCAGCAATTCGTACAGCTTACCGAGGAAGCGAAGCGGGGTCCGC
CGAGCCTTCTGCTTGATTGGCGCTTGCCCCTGTACATTGATGTCACACACGACCCCGTAGGCTGGAGGCGGCAGGGCGTTACC