Description :
From Genome Similarity Track
Location :
Scaffold_23:266811- 269691
Transcript NameFunction/comments
Hyaar_Emoy2803825hypothetical protein

Sequence
2880 bases(100 bases per row)
TGGAAACTAGTGTCTCACATTCATACGGACCTTAGATTGGTCGTCAGAGGACTCAGCAATCAGCTCATTGGAAAAATTGGTGATTACCCAAAGAACCGGG
TTGGAACTCACAGCCGAAACCTGTACTATCTATTCCTGTTAGGGTTATACGTCAGGCATATTCAGTCCCACAAGGACTCACCGGAAAAGTGTACGCATGT
CTTCGACTTAGAATAATTTTTTGGGAAAAAAATGCCCCATTTAATCACGAAAATAAAAATGCCCCACGTTCTCGTATACTCAAGTTAACGTGGTACACTT
ATACTGATATGATGCTTTGATGAAGGACTTAACCTACTATAATCACCATTCACACGCAATATGCTGATACGTCTGACTTTCTTTACCTCAGGACTCTCCA
CGTCCAGCGTGCTGTCCATTAAGTTTAAAATCATTAACATCACCAACTAATCCCTGCAACAGCACTGAAGTGTCGCCATCAGCACTGGTAAAGCCTTCAA
ATTAGTAAAATGAGAGTCAAACAGATAGAATGGATTCATGATTATATATTTAAATGGGTAAATATGGTCTAAGTTACTATAGCGTACGAGCAGGAAGTGA
ATTCCTATCCTACAACTAAAACAGCAGCACTGTAGTACCAAAAACACCACAGAACAGTAGTAACACCACGAACACTAACAGTAGGAGCAAGAGCAGCAGT
ACCAAAAGGAGCAGTAGCAGCAGAACACACACCAGTACCAACAACAGCAACAGCAGCAACGACAACAATAATAACAATGACATTAGCAGCACCACCAGCA
GCAGCAGCAGTAACATAGTAACAAGAACATCATAAAGAACTTACAACAACAACGGCTACAGCGGCAGCGGTAGCAGCAACAACGACACGACCAACTGAAA
CAAAAATAACAATAGTATCAGTTATAACATGAGAAAACAATAATAACAATAACAAAACAATACCAAAATAATCCCATCAATAAAATCAGCACCGGTTGTC
TACGTTTACGGCTGCAGCTGACGATACAAAGATGCGTTTTCATCTTTTCTGTGCCGACCGCGCCCACAATTGGCGGCTGGGAGCGCAGCACGCCCGCGGC
GAAACCCCCTCCCCGGCTCCACCTACAGGGCGGGGGTCGAGCACAGCCGTACAATGGAACTGAGATATGACTAAGATATGAATTTTTATGTGTACCACTT
TAACTTGAGTATACCGACGTGGGGATTTTCTTTTATTTTCTCATTACCTGGGGGCACTTTTTATTTTCCAATTATCTGGGGCCTTTTTTTTATTTTTCAA
TTATCTGGGGCATTTTTTTCGTGATTAAATGGGGCTTTTTTTATTTACCCTATATGTTTTGAATTTGTTTCCTCTTTTCTATACGTTTGGAGCCACTTAG
CGATTTGCCTCCTTATTCTGTTCTTTCTATGCACAAAACAAATGAAATGAATGGACGATCATCCTCTTCTTGAGTGATCCTTAGCACGCACCGATTGCCA
GTCAATCACACAACCACTGTCGTTTTGTAGCAAGGATAATGCCTCAGCGATATTATTAACTGAGAAGGTATCGCTCATAAAGCGACTATGTTTGGCACTA
TCTTTGGTATAGATCCGGTATAGTCAATTCCCTACATCAGAGCAAGAATCAATTCATTCTGATACCTTCTGTACGCCATGTGAAGCGGATCTGCATAGCT
CTTAGGTGCGATGAATACTTTCGGCTGATAGCCACTTTGTAACGGGGTAAGAGCCCGTTACGCTTACACACACTATAGGTCTTACGTAGTAGCGTAAGAG
GACACGCGTTTAATTAACGCGTGTCATTTAAACCATAATCAACTCTGATTTTTATATTTTATATTTAAGCTAAAATAATCCTAAGTACGAGTGCTCTCCC
GTCTCACGAGAGCCACTCACAATGATGTTGCATCCAATTAGCTAATAATGGATCTGAGTCCCACTAATCAGCAAAATAGGAATACGGCGCACTATACCCG
ATATCTCGGGTACAGTGTATACAAACTATATACTATATATGCTTACTTATCTTTATGATCATGTGAGGATCCGCTAAATAACATATATAGCGTTATTGTG
TAGCAGTGACACCCCCGGTACACGACCCCCCTCATAAATAGCACATACTCTTATGTGGGAAAAGAATGAAATAAAGAAAGAAACACTCGCGATAGCCAGC
GACATCGTTGCCGTAGTGGGACGATCACACACGATCATGGCCGTGCGAGACGACACACATCGAAAAAACGACGGACAGTCGAGACGCGATTACAACAACG
CCAGCTAGCGAAGTGAGAAGCCCAGGAGCACAACACCGAGCGACAGCGACAGTAGCAGCAGATATCCCTTTCCCGCGTAAATACGCGTGGTCCTTCGCAT
CTGGGAGCTGTATAACTGCAGCGGGATGGAACGCTTTTGCGGCGACCTCGAGGTATGCGAGATGTGGCAACAGTGGAGACGCGCCCGCGGCAAGCCAACA
ACGGTGGCACGCGCGGTGACACAATCTTCACTGGACGCATCCTGGACCGCCTTCGTTCGCTGATGGAACACCAAATCGGGATTGGAGAGCTCGTATCGAT
ACTGGAAGCGTGGCAAATTCGTTACGGACTCGCGAAGACCCGCAAGAAAGTCGGTGCATTATCGTGGGACGCAGACCGGCCGTGTTGCATCGCTCATTCC
CTTAAGGGTTGTCGAAGCTGTGAATGCCCAGGCGTAGCGCGGACTGCCCGCTCTCTATGGTCAACGATACTCGTGGATTACCCATTGTCTGAAGACAAGC
GCACTTGCGTCGGGAGATACCAACGAAACATCGACGGGTATCAGCGCGCACGACAATATGGTCGAGCATGGCAACGAGCA