Description :
From Genome Similarity Track
Location :
Scaffold_6:2667791- 2671574
Transcript NameFunction/comments
Physo_265395Avh456

Sequence
3783 bases(100 bases per row)
GCAGCCCCCTAGAGGCACGCGCCACGCACGCAAAGGTCATGAGGCTCGTAGCAGGGACCCAGTCGAGTAGACAGCGAAGTGCAACCACAACACGTGCTGG
GCTCTGGTATAAACCGTCACGAAATGGCTAGTCCACACCAAAATGCGTGAAATCCACAATAACCAAAAGAGCAGATAGTCCGCATTCTCTATATAGCCCA
ATCGACGCGAAGTTTATCGCCGTCCCCATGCGGTGCACCCCAGCTGCCTGCACACGAATGAACGCCACGATTAGTACCTGAAACACGGATGAGCATGCGA
CGCAGCCACGAACCTGTGACGAAGCTCCACCGCTCGCCGCCGCCACTGCTTGGCCCCACGCCACCATGCGAGCTGCACACACGTAAAATAGTACCCATAG
TTAGCAGCCAAAAGAGCAGATAGCAAGCTTGAAGGCCGATCCCATGCACGTCACTACAACCTGCCAGCTCTGCTCCGCATTCGAGCCCCGGCGCGGCAAA
TTCGCGAATGGCGAGTAGTGGGTTGAAGTCGCGGCTAGCGCTGTCCTGTTTAATGCGAAACACGACAGCTAATCCTTCTTTACGACCTTTCGGTACACTA
GCATTGCTACATGGCTTGGTAGATAGACTGACATTCACTATGCTAGTGCTGACATCCCTACAGACTGATACATAGGCTAATAAATAGATTTGGCTTCAAT
ATACTGTAACTTCGAGGACGGTGTCTTGTTTGGGCCAAACCAAGACAGCTCACCCATTCACTTCTTCGCTACTGACTGAGTGATTAACTGTTTGTATTGT
ATACTTCAGTTCACTATTGCTATGCTTCTCCTAGTACTGCAGCCAACAGGGCAGTGGCAGCGAGCCCAAGCCAGGAAAGTCTAGCCAGCGCGGCCCAGCC
AACGGCGCTCCCCAACAGCGTTATGGCTCAGCCCTCGAGACAGCTTGTGGGCGTGTAGCTAGCTACTGTAGCATCAAACACGATACGCATATACTACAAC
ATCAGTAGATAAAATGTGTCTGCATTCCTCTCTATCCATAACTACTGCCCATCTTTTCAATGCAGCCGCTACTACCTAGCCGTGTGTTGCTGATGGTAGC
GCGTCCCAGCCTGTCATATATTTCCCTATATTATTCGGCCGGTATTCGGCGGTATCGGCCAGCGCTGGTAGTAAGTAGTTGCGAAGTAACACTAAAATGA
AATAATAAATGGACTCGGGGGTACAATTTTTTAGCGTGTATAATACAGGGTTTAGTATGGGGGAAGAAATAAAATAAAGACTGGGGGGGCAATTGTACCC
CTGGGGTACAATTCCAAAGCACGTGTACTAGTCAGTCCTAACGAACTGTTAATTGTGCTTTGCAAACGTTCTGTCGTTTTGACTTGGAGCTCTCCTCGAT
TTATCATTATAATAAGTCGAGGTCGATGTAATAAAACGAGGTCAAAGAAAGGGACAGGTCATTTAGGCCGGCTAATAACTCGAGCTACGACAATCCAAAT
TAGGGCTTGAGGTCGATCTCCGGTGGATCTGGACAGAACGAGGTCGATCTGCCAAATCGATTCCTTTTGCGTTTCAAAGGCGCAAATCGAGGTCGATCTA
CGTAAATCGAGGTCATCCATGCTACCGTCTCTGTTTTGTGCCCTGATTTGTGGGTCAGCCCTCCTCGATCTAGGCCATTAAACAGGGCGACATTTTATCT
GCAAAGCCACAATAAAACGAGTAATACAATCCTATATTACTTAACTGACGGCAGAGTATTATTAGAAGTATGAGTGATCGACAAGAGTAATAACTAGAAT
TATAGTAGTACTTTGGATGAAGCTAGTAAAATGGAGACCACAGTGTCCTCGCCGTAGATCCGATGGTGTTCTTCGATACAATAGATGCCATTACTTCTCG
GAAACGATACATTGTGTTTGTACGAAATAATTCCCCGTGAAGATTAGACCCTTGTCTCGTGTACGAATCGTCGGCTGCAAATATGCCATATGCCGATGAG
TCTCGTACTGAAGTGGTTTTCAACTATTTTGCCGCCCGATTTGACGTGTTATCTCGGAGTCCGATTTATATAAAATGGAGCTCCCACATGATCGGTTAGT
CCAATTTAGCTATATCTGACCTGAGTTAGTAGCATAAGGCTCAAAGGGGAGGCATTCCAAGTTGGACATACCTCCCCACTTCTCATGACGCATTAGAACT
GCAAGACATTGGGGACAATAGTACACTGTATATAGCCACTTCATAGCACTATGGCCAGCTAAATCACCTGTGTGAACATCTACGGCCGCTACAACTTCGT
GCCACGCCGATCTGAGAGGGCCCCAGACATGTTTTCGCGGCGGTCCCTTTTGCCGGCAAAAAGCGGCATTTCTGGTCCCTGCTTCGCAACTCGCAGCCCC
CAGACGCAAATCGGGCCAGATATAGTTTGCTTCCCTCAGTCCTTCCTGCTAAATCGGAGCCCTCCAGCAAATCGGGCCCGATATATCGGATCTTGGACCA
CCCGATTTGCCAAAACGGATGAAAGCCACGATACATATGCATAAATCCATGTTATAATGAAGAAGAAGAAGAAAAAAAAAGAATCGAGATTGCAAGTTAC
CTCAAGATGTGTTATAATAGTTGTCTAGCTGCTAATGAATGCCTTGGGTTATCTTGTGCGGTCAGCAAACACAGTCGGCTGGTTGGAGTGTCCTCGCTAT
AGATAATCACGTGTTCAATGCGTATCGGATAACCAGGGAATGGTATAATCTGCGACGCTTCATCGCCGTACAGTACATGTATAACGCACTATCACAATGC
TGGTGAACTAGCACAGAGACCAGTCAGCTTCCCGTGATGCTGGCTTGCTCCATCGGTGTGTACCCACCACAAGCTCCAACCAAGCCCCTCTCATTTCCCA
GCTTGCTCTTAAGCACCCAAGTCGAACGATGCGCCTCCTCCGTCTGGCAGGGCTGGCAGGGCTGACATGCGTCGCAGTTGCCACGCGAGTTGACCGAATG
CGTCGGTTGCAGGTTCCTCTGTACTTGTATCCCATGCTACAAGCTGGTCTACTGTTCAAACTACAAGCCAAGATGATAGCCCCGCGACGAGATTTTTACG
AGCTGCACGAGCCAACCACGACGATGACGACGCGGAGAGAGCAGGATTCTCCCTGCCAGGTTTCGAAATGCTGACAACGCTCTTGAAGCCAACCCAAGCA
CAACTTCAGAAACTATTGATCAATGGAGAGTCCGCAGACGATGTTTTCACTCGCATGAAGCCGAATAAGGCTGGTAACTTGTTGTTGCACGACGAAGAGT
TCGCTCGGTGGCTCACATACGCTGACGATCTGAAGATCAAGCACCCCGCGATCAAGACGTCAGCGATCTTGACGTTGACTGCTCACTATGGTGACGATGG
TTTGTACAAACTGATCGAAGCTGGCCTAAAGAACGAAGGAACGGAAACAGTTGCAACGAAATTGAAAACCGAGCTAATGAAGCACTGGGTAGCCACTGCC
AAAGTCCCGGACAAGGTCTTTCACATTATGAAGCTTGACAAGGTAGAGACAGACATTCTCAGCAACCCCGAATTCATCAACTGGGCGCGGTACGTGGACG
ATTTCAATGCGAAGTACCACAAGCAGTCAACGTCGATGGTGCCGACAGTCCTGAACTACTACAGTGACGACGTTATCTTCAAAATGACCGAGGCGGCGAA
GAGTGTGGAAGAAACCAAAGCCATCGCCACCAAGCTGCAGGAAGAACTGGTCCAAGCCTGGTTGAAAAGCAAGAAAACACCAG