Description :
From Genome Similarity Track
Location :
contig_54:266756- 268620
Transcript NameFunction/comments
g10797.t1hypothetical protein

Sequence
1864 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGATCGGAGACAGCCTCATCCCGCGCTGTCTCTGGTGGAGGGCCGCATGCACCACGTGGTGCAT
GCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCC
GTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCTAGTTCTAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTAC
GCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGA
AGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCG
GCTTGTCATCTTCTTGCAGTGAAATTGACTCTCGCTGGGGGCAGCGATCTTCAATGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGG
CGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTTATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCACCGCGTGCACAGGTGCTGTGCACTC
GCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATACACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATT
GGTTCGGGACCTCCCGACGGCCGTACCACCGGTCGTGGTATCAGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTG
CGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCATCTCTAAGGCCTTTCATAAACGTGACGACCTTTGTCGCCTCGTCAA
TCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGGTCGAGGAACTCCGCCCTCGA
TCGGAACTCGTTCTGTGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCCATGAGTCGGCGTCCGTCC
GCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGA
CAAGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGACGGATGCCGACACCGAAGC
TCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGTT
TCTCCAATGACCGTCGACTGTCGTTGGAGGGCCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCACAACATGCGTTGCAGACGTGTTTCGGC
TACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACCAACAAGTG
CTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATAC
TTGTATCCACAAGTATACTTAAACTAAGACAAAGGAACGAACAATAGCTTTGGTGCCAATGAGA