Description :
From Genome Similarity Track
Location :
contig_47:266754- 269316
Transcript NameFunction/comments
g9230.t1hypothetical protein

Sequence
2562 bases(100 bases per row)
TACTTTGTTGATGTACTTGTTCGTGGTACTTCCGTTGATACACTTTCACAATTGTTGACCAGCTCCAGAAACTAATCGCCTATTGCCAGCGCGAATGCTC
GGGAACTGAAAGAGGCCGCGCTTCAGTTGCTTCGTGTTCGTTGCTTTTGCTCGTTTGAATCCGCTGCTTGCTGCTGTACTCTCTTATCAACCGGAGATTT
GACTGTTGCCGCTAATTTTTGCTTGCTATTATATAATAGCTGAGCGACGCATCCAGTACTCTGCGCCAAAGCACCTAGGCGGCATATACGAAGAGGCTGT
TGCGAATAGATACAGCAACCTCGTTCAATGATGGGTGCCAGCTAGTCTGCAGGATCTTCTTCGAGAAATCCAAAGCATCAGGGTCGCCTGGAGCGGGCAT
TGCAGCAATCTGCTGCGCGAGGCCTCGCTGGGGCATGGAGTGCCGGCGGCTCACTCGAGCTGTGCGCGGGGTGATCGAAATATCGGCGCGTCCATAACGG
TCATAAATATGGAACTCGCTGTTATACGAGCCCGTGATGAAGTTGTTGCCATCCCCGCTGACCCCGCACTCGAATTTGTCGAAAATGCAATCACTCTCAT
AAAGATCCCCCAGTCGTGGACGAAGGTGCTCGTGGATCTAGACGTAGGAACAAACACGGTTAGTAAGACCAGCAACACCAGATCACCCTACCAGCTTTCA
ACGCCAATGCCGAAGCAGATATTGCACGACTTACATTGATCGTTTGAACCGGACGCGAGTTCATGTTGATGTCCCAGACTTTGAGAGTCAGGAAGTCGCG
TGCAATAATGTAGCGGCCGTCAGGAGAAAACTTGATGTCAGAGATCGACGCGATGATCTCAGAGAAAAAACTTCTGGCTTCAGGATCCTCCTGCTCTTCG
AAAACTGTAGCCCCGTAAGAAGTGTTCCTTATTAGGCACGCTTCACCAGGCCAACAACACAAAAAGTGCATCAGGAACAGTGCGCACCTTGAGAGTACGC
ATCACACAACGCCGCCTGCCGCATATCGCCCAGCTTAATGGCGCCGCGACTCGTGCTATACATCATCGTGTTGCAGTGCGTCGGGTGGAAATCCGCAGCT
GTGATAACCTCCGTGAGCTCTTCCATATTTGCTGGCTTGATGTCCACGATGTCTAACAAAACAACACCACCAACGCACATAAGTTAGAAATGGCATTAGG
CGACAACAAAAGCGAGCATCGACGAACTGAAGCTTTGATTCGAGATGCCCAAGCTCCACAGATTCACACGAAGGTCATCCGCCGACATGAACGTCTCTCC
ATCGCTGTTGATCGCGATCGAGTTGATGTGATACGTATGTGCGTTCGCGTAGACGCGTTTGGCCGTGGACGTCGTCACCTGGCCGCGAACATTGGTCTGT
GGTAGGCGAATGAGCTCTGGTGTGATTTGGGCCCGTGGCACGTGAGCGAGTCCCTGTTCGTTGTACGTGGTGACTTCACGCACGCTTCGCTCGTGTACCT
TCCAGAGTTTGATAGTCTTGTCGTTTGTAGACAGGAGGCACTGGGACCCGTTGGACGGTCGGCACCATTTGATCTGGTTGATCTTTTCCTCGATCTCCAG
ACTTTTGAGGTAGTCGAATTCGGCATTATGGCTCTGGAACTCGGCGTACAGCTGATACTGCGGGTCGTTCATCCCGCTGTACATGGTTTGATTCTGATTT
GGACAACATACAATGTCAGAGGATAAGACCTGCAGGTAAACTCCATAAGAGCACGGACCGACGCAAGGTTTCCATGACGACAGTAAATGGAGACTCGGCC
GCCCTTGTTCCCTGTGGCTAGAAAGTCTCCCGATCGGTCGTACTCAATCGCGGAAATCACCTCGGCTGCAGAGTCATCATCTGCAGTCAATAACCCAGCA
CCCTGAAAGCTGTAACGCCACCGAATCCCTACCTTCAACGAAGCTCCGGGCGCTTTCGCCCGCGGAAAAGACCTGACCCCACTCGGCTTCAGCTTCGCCT
GTGGGTTCTGCCATGTTGACTTCCAAAGCGCCGGCGTTAGTGTGCTTGAGCCTGGTCAGCGCACCCACTCGGCCCTCTTCGCCTCCGATGTCTCCGTGGA
GATTGGTTTGCGTCATGCAGACGCGAGGGGGTTGGGAGCTGCTCTCGACACGACCGTCTGCTTGGCGCTGTAAGAAGCGAAGCTGGCCAACGGACTGCTG
CACCTGCTGCTTTCGCCTTGGGGGTCCTTCTCTTCTTTCGCCGGAGGATCTCGAGGTGTTGCCTCAAAGGCCGCTTTGCTCCTCGGCTGGGGGTTTCGTT
TTTCACGCTAGCAGAAGGGCGGGCGCGACCACTTGGAGAATGGACGGACGAACGCAAGGCGAGGTCAGCACTCGAGGGCTGAAGCGACGACGGCGTCTGA
AGGATCTGCGGTGATGCAAATCCCGTTGTTGCCTGCTGGATGGAGTTGTCACGAGGCGACGAGCTCGAACGATGCGAATGGGGTCCCTCTCAACCGACCA
GACGCTGACAGGCATCGCGATCTTCAATCGCATTTTTTTTTCCATTTTTTGCTATGTACTGC